Incidental Mutation 'R5579:Itpr2'
ID 438266
Institutional Source Beutler Lab
Gene Symbol Itpr2
Ensembl Gene ENSMUSG00000030287
Gene Name inositol 1,4,5-triphosphate receptor 2
Synonyms Itpr5, Ip3r2
MMRRC Submission 043267-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5579 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 146108299-146502223 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 146173366 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 2297 (R2297*)
Ref Sequence ENSEMBL: ENSMUSP00000078526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053273] [ENSMUST00000079573]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000053273
AA Change: R2330*
SMART Domains Protein: ENSMUSP00000049584
Gene: ENSMUSG00000030287
AA Change: R2330*

DomainStartEndE-ValueType
low complexity region 68 80 N/A INTRINSIC
MIR 112 166 1.1e-5 SMART
MIR 173 223 8.9e-6 SMART
MIR 231 287 5.11e-6 SMART
MIR 294 402 3.73e-8 SMART
Pfam:RYDR_ITPR 473 670 1.5e-62 PFAM
low complexity region 882 890 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1346 1.6e-16 PFAM
low complexity region 1773 1785 N/A INTRINSIC
low complexity region 1897 1908 N/A INTRINSIC
Pfam:RIH_assoc 1912 2022 4.6e-34 PFAM
low complexity region 2088 2098 N/A INTRINSIC
transmembrane domain 2228 2250 N/A INTRINSIC
Pfam:Ion_trans 2260 2552 5.1e-20 PFAM
coiled coil region 2631 2686 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000079573
AA Change: R2297*
SMART Domains Protein: ENSMUSP00000078526
Gene: ENSMUSG00000030287
AA Change: R2297*

DomainStartEndE-ValueType
low complexity region 68 80 N/A INTRINSIC
MIR 112 166 1.1e-5 SMART
MIR 198 254 5.11e-6 SMART
MIR 261 369 3.73e-8 SMART
Pfam:RYDR_ITPR 438 644 5.4e-75 PFAM
low complexity region 849 857 N/A INTRINSIC
Pfam:RYDR_ITPR 1148 1322 7.2e-60 PFAM
low complexity region 1740 1752 N/A INTRINSIC
Pfam:RIH_assoc 1875 1994 5.8e-35 PFAM
low complexity region 2055 2065 N/A INTRINSIC
transmembrane domain 2195 2217 N/A INTRINSIC
transmembrane domain 2230 2249 N/A INTRINSIC
low complexity region 2268 2279 N/A INTRINSIC
Pfam:Ion_trans 2281 2507 2.4e-12 PFAM
coiled coil region 2598 2653 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the inositol 1,4,5-triphosphate receptor family, whose members are second messenger intracellular calcium release channels. These proteins mediate a rise in cytoplasmic calcium in response to receptor activated production of inositol triphosphate. Inositol triphosphate receptor-mediated signaling is involved in many processes including cell migration, cell division, smooth muscle contraction, and neuronal signaling. This protein is a type 2 receptor that consists of a cytoplasmic amino-terminus that binds inositol triphosphate, six membrane-spanning helices that contribute to the ion pore, and a short cytoplasmic carboxy-terminus. A mutation in this gene has been associated with anhidrosis, suggesting that intracellular calcium release mediated by this protein is required for eccrine sweat production. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a knock-out allele are viable and fertile but show decreased sweating and disturbed calcium signaling in sweat glands. Mice homozygous for a different knock-out allele have atrial myocytes that are significantly less prone to develop proarrhythmic disturbances in calcium signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,700,275 (GRCm38) S345P probably benign Het
6430573F11Rik T C 8: 36,512,041 (GRCm38) V266A probably benign Het
Abca3 G T 17: 24,376,729 (GRCm38) C352F probably damaging Het
Abce1 A T 8: 79,700,586 (GRCm38) I237N possibly damaging Het
Acrbp A G 6: 125,061,099 (GRCm38) D421G probably benign Het
Adam8 T A 7: 139,988,984 (GRCm38) Y201F probably benign Het
Adgrf1 T A 17: 43,311,064 (GRCm38) C731S probably damaging Het
AF067063 T A 13: 119,828,415 (GRCm38) M82L probably benign Het
Akap8l A T 17: 32,321,942 (GRCm38) I529N probably damaging Het
Akap9 G A 5: 4,064,714 (GRCm38) G114D possibly damaging Het
Alox12b T A 11: 69,162,932 (GRCm38) D158E probably benign Het
Ankrd11 A G 8: 122,884,231 (GRCm38) S2639P probably damaging Het
Ankrd42 T C 7: 92,590,182 (GRCm38) Y466C possibly damaging Het
Apobr T C 7: 126,587,675 (GRCm38) I786T probably benign Het
Arhgef12 C T 9: 43,010,193 (GRCm38) G329R probably benign Het
Btnl1 T C 17: 34,381,552 (GRCm38) probably null Het
Ccdc174 A G 6: 91,881,350 (GRCm38) probably null Het
Ccdc183 T C 2: 25,615,422 (GRCm38) D177G possibly damaging Het
Cd14 A G 18: 36,726,235 (GRCm38) Y56H probably benign Het
Cep162 G A 9: 87,203,671 (GRCm38) A1200V probably benign Het
Clic3 T C 2: 25,458,307 (GRCm38) L128P probably damaging Het
Cntnap5b A T 1: 100,383,395 (GRCm38) R538* probably null Het
Cntnap5b A T 1: 100,383,399 (GRCm38) Q539L probably benign Het
Coq7 A T 7: 118,517,335 (GRCm38) N214K unknown Het
Cramp1l G A 17: 24,973,113 (GRCm38) H1018Y possibly damaging Het
Crtac1 T A 19: 42,304,806 (GRCm38) D288V probably damaging Het
Dab2ip C T 2: 35,715,327 (GRCm38) R132* probably null Het
Dis3l C A 9: 64,330,835 (GRCm38) C125F probably benign Het
Dnmt1 A T 9: 20,920,205 (GRCm38) V543D probably damaging Het
Dock9 A T 14: 121,599,695 (GRCm38) L67Q probably damaging Het
Ehbp1 A T 11: 22,137,846 (GRCm38) S413T probably damaging Het
Endov A G 11: 119,505,097 (GRCm38) I158V probably benign Het
Epb41l4b A G 4: 57,064,802 (GRCm38) V469A possibly damaging Het
Etf1 G A 18: 34,913,601 (GRCm38) P119S probably damaging Het
Fam135a A G 1: 24,029,727 (GRCm38) L491P possibly damaging Het
Fancd2 A T 6: 113,560,051 (GRCm38) probably null Het
Fank1 T A 7: 133,869,329 (GRCm38) probably null Het
Fbxo18 A G 2: 11,748,993 (GRCm38) I846T probably damaging Het
Gas2l3 T C 10: 89,414,066 (GRCm38) T397A probably benign Het
Gga1 T C 15: 78,893,188 (GRCm38) V513A probably damaging Het
Ggt1 T C 10: 75,585,948 (GRCm38) V543A probably damaging Het
Gm11596 A T 11: 99,792,891 (GRCm38) C134* probably null Het
Gnal C T 18: 67,088,771 (GRCm38) R82C unknown Het
Hat1 T C 2: 71,410,238 (GRCm38) V92A possibly damaging Het
Icosl C T 10: 78,073,763 (GRCm38) R181C probably damaging Het
Ift46 A G 9: 44,786,863 (GRCm38) M208V possibly damaging Het
Ighv1-26 T C 12: 114,788,599 (GRCm38) K42E possibly damaging Het
Ipo5 A G 14: 120,938,613 (GRCm38) K617E probably benign Het
Irx5 A G 8: 92,359,913 (GRCm38) D208G probably benign Het
Itgal T G 7: 127,306,929 (GRCm38) V397G probably benign Het
Itpr3 A G 17: 27,113,519 (GRCm38) D1779G probably damaging Het
Krt4 T A 15: 101,921,234 (GRCm38) E286D probably benign Het
Loxl4 C T 19: 42,604,290 (GRCm38) G317E probably damaging Het
Mapk6 T G 9: 75,388,062 (GRCm38) H718P possibly damaging Het
Mark2 A C 19: 7,282,816 (GRCm38) V14G probably damaging Het
Mbd5 A G 2: 49,272,814 (GRCm38) T1103A possibly damaging Het
Mcph1 A G 8: 18,632,293 (GRCm38) E482G probably benign Het
Mme G A 3: 63,348,645 (GRCm38) E509K probably damaging Het
Mrgbp A G 2: 180,585,483 (GRCm38) T204A probably damaging Het
Mycbp2 A T 14: 103,291,333 (GRCm38) F430I probably damaging Het
Myo6 A G 9: 80,217,720 (GRCm38) D27G probably damaging Het
Ncoa6 A G 2: 155,406,677 (GRCm38) L1569S probably damaging Het
Ndc1 T A 4: 107,380,704 (GRCm38) F235Y possibly damaging Het
Nmur2 A T 11: 56,033,009 (GRCm38) S240T probably benign Het
Olfr1176 A T 2: 88,340,413 (GRCm38) I283F possibly damaging Het
Olfr301 T A 7: 86,412,726 (GRCm38) Y121* probably null Het
Olfr608 G A 7: 103,470,914 (GRCm38) V292M probably damaging Het
Osbpl1a A C 18: 12,892,262 (GRCm38) S333A probably benign Het
Osbpl1a G T 18: 12,841,192 (GRCm38) A62E probably damaging Het
Otud4 C T 8: 79,664,108 (GRCm38) T417I probably benign Het
Pagr1a T C 7: 127,015,442 (GRCm38) E197G probably damaging Het
Pcdh18 T C 3: 49,744,977 (GRCm38) Q1012R probably damaging Het
Pcdhgb5 A C 18: 37,731,637 (GRCm38) I162L probably benign Het
Pdpr T A 8: 111,123,816 (GRCm38) Y462N probably damaging Het
Pkhd1 A T 1: 20,523,142 (GRCm38) H1582Q probably damaging Het
Polr1b A G 2: 129,110,108 (GRCm38) K352R probably damaging Het
Poteg G A 8: 27,448,037 (GRCm38) V12M probably damaging Het
Pou2f1 A C 1: 165,915,162 (GRCm38) V54G probably damaging Het
Ppme1 A G 7: 100,344,975 (GRCm38) L177P probably damaging Het
Prkce A G 17: 86,619,948 (GRCm38) D550G probably damaging Het
Prrc2c A G 1: 162,680,758 (GRCm38) probably null Het
Ptpn22 A G 3: 103,882,139 (GRCm38) probably null Het
Rabif G A 1: 134,506,205 (GRCm38) V86M probably damaging Het
Rbm25 T A 12: 83,668,507 (GRCm38) M484K probably benign Het
Rcn2 G A 9: 56,057,429 (GRCm38) A224T probably benign Het
Rexo5 T A 7: 119,834,403 (GRCm38) probably null Het
Rnase1 A T 14: 51,145,762 (GRCm38) I45N probably benign Het
Rnmt T A 18: 68,306,115 (GRCm38) D98E possibly damaging Het
Rprd2 A G 3: 95,785,059 (GRCm38) F188L probably damaging Het
Scube2 G A 7: 109,810,737 (GRCm38) T643M probably damaging Het
Slc7a15 T C 12: 8,539,344 (GRCm38) I68V probably benign Het
Slco1a5 A T 6: 142,242,125 (GRCm38) V496D possibly damaging Het
Slitrk6 T G 14: 110,751,217 (GRCm38) S353R possibly damaging Het
Smpd5 T A 15: 76,295,125 (GRCm38) I53K possibly damaging Het
Tas2r108 T C 6: 40,494,087 (GRCm38) S166P probably benign Het
Tecpr1 C A 5: 144,214,344 (GRCm38) V245L possibly damaging Het
Tenm3 G T 8: 48,236,764 (GRCm38) N1929K probably damaging Het
Tigd5 T G 15: 75,911,025 (GRCm38) F412C probably damaging Het
Timm17a A T 1: 135,306,188 (GRCm38) S74T possibly damaging Het
Tle1 A T 4: 72,139,808 (GRCm38) L60Q probably damaging Het
Tmem132d T C 5: 127,796,000 (GRCm38) E515G possibly damaging Het
Tmem65 T C 15: 58,794,397 (GRCm38) N115S probably benign Het
Trmt5 C A 12: 73,281,652 (GRCm38) R259L possibly damaging Het
Ttc37 T C 13: 76,185,200 (GRCm38) W25R probably damaging Het
Vmn2r50 A T 7: 10,050,089 (GRCm38) W153R probably benign Het
Vwa3a T G 7: 120,768,173 (GRCm38) S184A probably benign Het
Zbtb25 A G 12: 76,349,164 (GRCm38) L428P possibly damaging Het
Zbtb49 C T 5: 38,200,816 (GRCm38) D698N probably damaging Het
Zbtb8os T G 4: 129,340,735 (GRCm38) D35E probably damaging Het
Zfp316 T C 5: 143,264,491 (GRCm38) T56A unknown Het
Zfp334 A T 2: 165,380,487 (GRCm38) C545* probably null Het
Zmiz1 C A 14: 25,644,856 (GRCm38) S247R probably damaging Het
Zscan18 A G 7: 12,775,381 (GRCm38) probably benign Het
Zzef1 T C 11: 72,900,637 (GRCm38) V2189A probably damaging Het
Other mutations in Itpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Itpr2 APN 6 146,397,012 (GRCm38) missense probably damaging 0.99
IGL00163:Itpr2 APN 6 146,390,836 (GRCm38) missense possibly damaging 0.88
IGL00229:Itpr2 APN 6 146,144,185 (GRCm38) missense probably damaging 1.00
IGL00712:Itpr2 APN 6 146,232,436 (GRCm38) missense possibly damaging 0.63
IGL00952:Itpr2 APN 6 146,158,961 (GRCm38) missense probably damaging 1.00
IGL00983:Itpr2 APN 6 146,310,981 (GRCm38) splice site probably benign
IGL01012:Itpr2 APN 6 146,345,161 (GRCm38) missense probably damaging 1.00
IGL01289:Itpr2 APN 6 146,112,535 (GRCm38) nonsense probably null
IGL01411:Itpr2 APN 6 146,376,062 (GRCm38) critical splice donor site probably null
IGL01557:Itpr2 APN 6 146,158,976 (GRCm38) missense probably damaging 0.99
IGL01669:Itpr2 APN 6 146,180,229 (GRCm38) missense probably damaging 1.00
IGL01809:Itpr2 APN 6 146,227,581 (GRCm38) missense probably damaging 1.00
IGL01814:Itpr2 APN 6 146,232,546 (GRCm38) missense probably benign 0.02
IGL02198:Itpr2 APN 6 146,323,227 (GRCm38) missense probably damaging 1.00
IGL02218:Itpr2 APN 6 146,240,262 (GRCm38) splice site probably benign
IGL02332:Itpr2 APN 6 146,426,542 (GRCm38) missense probably damaging 1.00
IGL02425:Itpr2 APN 6 146,391,321 (GRCm38) missense probably damaging 0.99
IGL02432:Itpr2 APN 6 146,325,173 (GRCm38) missense probably benign 0.05
IGL02726:Itpr2 APN 6 146,375,921 (GRCm38) missense probably benign 0.18
IGL02851:Itpr2 APN 6 146,385,979 (GRCm38) missense probably damaging 0.99
IGL02933:Itpr2 APN 6 146,312,904 (GRCm38) missense probably benign
IGL03015:Itpr2 APN 6 146,375,937 (GRCm38) missense probably benign
IGL03067:Itpr2 APN 6 146,325,182 (GRCm38) missense probably damaging 1.00
IGL03093:Itpr2 APN 6 146,379,510 (GRCm38) missense probably damaging 1.00
IGL03214:Itpr2 APN 6 146,180,244 (GRCm38) missense probably benign 0.02
IGL03275:Itpr2 APN 6 146,158,877 (GRCm38) splice site probably benign
IGL03332:Itpr2 APN 6 146,144,149 (GRCm38) missense probably damaging 0.98
IGL03352:Itpr2 APN 6 146,157,104 (GRCm38) missense probably damaging 1.00
IGL03377:Itpr2 APN 6 146,329,758 (GRCm38) missense probably benign
IGL03377:Itpr2 APN 6 146,329,715 (GRCm38) missense probably damaging 0.96
dollar_short UTSW 6 146,397,019 (GRCm38) nonsense probably null
enfermos UTSW 6 146,234,006 (GRCm38) missense probably damaging 0.98
Hopla UTSW 6 146,194,598 (GRCm38) missense probably damaging 0.98
P0029:Itpr2 UTSW 6 146,379,489 (GRCm38) missense probably damaging 1.00
PIT4431001:Itpr2 UTSW 6 146,354,720 (GRCm38) missense probably benign
PIT4453001:Itpr2 UTSW 6 146,373,173 (GRCm38) missense probably damaging 1.00
PIT4504001:Itpr2 UTSW 6 146,229,871 (GRCm38) missense probably damaging 0.99
R0040:Itpr2 UTSW 6 146,345,140 (GRCm38) missense probably damaging 1.00
R0040:Itpr2 UTSW 6 146,345,140 (GRCm38) missense probably damaging 1.00
R0048:Itpr2 UTSW 6 146,232,291 (GRCm38) splice site probably null
R0048:Itpr2 UTSW 6 146,232,291 (GRCm38) splice site probably null
R0055:Itpr2 UTSW 6 146,323,133 (GRCm38) missense probably benign 0.42
R0055:Itpr2 UTSW 6 146,323,133 (GRCm38) missense probably benign 0.42
R0088:Itpr2 UTSW 6 146,241,185 (GRCm38) missense probably benign
R0089:Itpr2 UTSW 6 146,350,022 (GRCm38) critical splice donor site probably null
R0114:Itpr2 UTSW 6 146,312,879 (GRCm38) missense probably damaging 1.00
R0125:Itpr2 UTSW 6 146,240,453 (GRCm38) missense probably benign 0.00
R0144:Itpr2 UTSW 6 146,327,155 (GRCm38) missense probably damaging 0.98
R0180:Itpr2 UTSW 6 146,501,909 (GRCm38) start gained probably benign
R0211:Itpr2 UTSW 6 146,194,613 (GRCm38) missense probably benign 0.17
R0305:Itpr2 UTSW 6 146,311,103 (GRCm38) missense possibly damaging 0.63
R0367:Itpr2 UTSW 6 146,234,008 (GRCm38) missense probably damaging 1.00
R0374:Itpr2 UTSW 6 146,359,392 (GRCm38) missense probably benign 0.00
R0391:Itpr2 UTSW 6 146,229,773 (GRCm38) missense probably damaging 1.00
R0450:Itpr2 UTSW 6 146,417,979 (GRCm38) missense possibly damaging 0.66
R0464:Itpr2 UTSW 6 146,375,889 (GRCm38) missense probably damaging 1.00
R0510:Itpr2 UTSW 6 146,417,979 (GRCm38) missense possibly damaging 0.66
R0532:Itpr2 UTSW 6 146,112,400 (GRCm38) missense probably damaging 1.00
R0625:Itpr2 UTSW 6 146,166,651 (GRCm38) missense probably benign
R0633:Itpr2 UTSW 6 146,374,456 (GRCm38) missense probably damaging 1.00
R0636:Itpr2 UTSW 6 146,171,412 (GRCm38) missense probably damaging 1.00
R1086:Itpr2 UTSW 6 146,350,045 (GRCm38) missense probably damaging 1.00
R1352:Itpr2 UTSW 6 146,111,742 (GRCm38) missense probably damaging 1.00
R1631:Itpr2 UTSW 6 146,180,290 (GRCm38) missense probably damaging 1.00
R1655:Itpr2 UTSW 6 146,376,148 (GRCm38) missense probably damaging 1.00
R1767:Itpr2 UTSW 6 146,350,068 (GRCm38) missense possibly damaging 0.91
R1779:Itpr2 UTSW 6 146,158,901 (GRCm38) nonsense probably null
R1796:Itpr2 UTSW 6 146,296,673 (GRCm38) missense probably benign
R1815:Itpr2 UTSW 6 146,359,416 (GRCm38) missense probably benign 0.08
R1827:Itpr2 UTSW 6 146,328,332 (GRCm38) missense probably damaging 1.00
R1828:Itpr2 UTSW 6 146,328,332 (GRCm38) missense probably damaging 1.00
R1884:Itpr2 UTSW 6 146,385,971 (GRCm38) missense probably benign 0.16
R1902:Itpr2 UTSW 6 146,229,703 (GRCm38) missense probably damaging 1.00
R1931:Itpr2 UTSW 6 146,240,354 (GRCm38) missense probably benign 0.41
R1964:Itpr2 UTSW 6 146,111,693 (GRCm38) missense probably damaging 1.00
R2010:Itpr2 UTSW 6 146,227,524 (GRCm38) splice site probably null
R2168:Itpr2 UTSW 6 146,111,678 (GRCm38) missense probably benign 0.05
R2179:Itpr2 UTSW 6 146,375,966 (GRCm38) missense probably benign
R2290:Itpr2 UTSW 6 146,422,828 (GRCm38) missense probably damaging 1.00
R2874:Itpr2 UTSW 6 146,426,498 (GRCm38) missense possibly damaging 0.73
R2888:Itpr2 UTSW 6 146,171,293 (GRCm38) missense probably damaging 1.00
R2897:Itpr2 UTSW 6 146,323,169 (GRCm38) missense probably damaging 1.00
R2897:Itpr2 UTSW 6 146,173,341 (GRCm38) missense probably benign 0.03
R2898:Itpr2 UTSW 6 146,323,169 (GRCm38) missense probably damaging 1.00
R2898:Itpr2 UTSW 6 146,173,341 (GRCm38) missense probably benign 0.03
R3024:Itpr2 UTSW 6 146,180,310 (GRCm38) missense probably benign 0.35
R3104:Itpr2 UTSW 6 146,312,837 (GRCm38) critical splice donor site probably null
R3607:Itpr2 UTSW 6 146,227,601 (GRCm38) missense probably damaging 0.98
R3732:Itpr2 UTSW 6 146,382,700 (GRCm38) missense probably damaging 1.00
R3732:Itpr2 UTSW 6 146,382,700 (GRCm38) missense probably damaging 1.00
R3733:Itpr2 UTSW 6 146,382,700 (GRCm38) missense probably damaging 1.00
R3792:Itpr2 UTSW 6 146,415,354 (GRCm38) missense probably damaging 1.00
R3806:Itpr2 UTSW 6 146,232,291 (GRCm38) splice site probably null
R3821:Itpr2 UTSW 6 146,417,726 (GRCm38) missense probably damaging 1.00
R3929:Itpr2 UTSW 6 146,374,359 (GRCm38) splice site probably null
R3958:Itpr2 UTSW 6 146,425,510 (GRCm38) missense probably damaging 0.97
R3959:Itpr2 UTSW 6 146,425,510 (GRCm38) missense probably damaging 0.97
R3960:Itpr2 UTSW 6 146,425,510 (GRCm38) missense probably damaging 0.97
R3960:Itpr2 UTSW 6 146,229,764 (GRCm38) missense probably damaging 1.00
R4074:Itpr2 UTSW 6 146,373,244 (GRCm38) splice site probably null
R4085:Itpr2 UTSW 6 146,144,248 (GRCm38) missense probably damaging 1.00
R4114:Itpr2 UTSW 6 146,425,510 (GRCm38) missense probably damaging 0.97
R4115:Itpr2 UTSW 6 146,425,510 (GRCm38) missense probably damaging 0.97
R4588:Itpr2 UTSW 6 146,241,196 (GRCm38) missense probably benign 0.33
R4663:Itpr2 UTSW 6 146,373,173 (GRCm38) missense probably damaging 1.00
R4673:Itpr2 UTSW 6 146,373,173 (GRCm38) missense probably damaging 1.00
R4684:Itpr2 UTSW 6 146,373,173 (GRCm38) missense probably damaging 1.00
R4686:Itpr2 UTSW 6 146,229,775 (GRCm38) missense probably damaging 1.00
R4713:Itpr2 UTSW 6 146,396,958 (GRCm38) missense probably damaging 1.00
R4713:Itpr2 UTSW 6 146,373,173 (GRCm38) missense probably damaging 1.00
R4729:Itpr2 UTSW 6 146,373,173 (GRCm38) missense probably damaging 1.00
R4732:Itpr2 UTSW 6 146,373,173 (GRCm38) missense probably damaging 1.00
R4733:Itpr2 UTSW 6 146,373,173 (GRCm38) missense probably damaging 1.00
R4801:Itpr2 UTSW 6 146,371,331 (GRCm38) missense probably damaging 1.00
R4802:Itpr2 UTSW 6 146,371,331 (GRCm38) missense probably damaging 1.00
R4877:Itpr2 UTSW 6 146,325,205 (GRCm38) missense probably damaging 1.00
R4970:Itpr2 UTSW 6 146,233,991 (GRCm38) missense possibly damaging 0.95
R4986:Itpr2 UTSW 6 146,240,342 (GRCm38) missense probably damaging 0.96
R5112:Itpr2 UTSW 6 146,233,991 (GRCm38) missense possibly damaging 0.95
R5200:Itpr2 UTSW 6 146,144,107 (GRCm38) critical splice donor site probably null
R5224:Itpr2 UTSW 6 146,166,651 (GRCm38) missense probably benign
R5243:Itpr2 UTSW 6 146,187,546 (GRCm38) missense probably damaging 1.00
R5348:Itpr2 UTSW 6 146,476,693 (GRCm38) missense possibly damaging 0.78
R5393:Itpr2 UTSW 6 146,376,155 (GRCm38) nonsense probably null
R5552:Itpr2 UTSW 6 146,294,080 (GRCm38) missense probably benign
R5744:Itpr2 UTSW 6 146,376,151 (GRCm38) missense probably damaging 1.00
R5825:Itpr2 UTSW 6 146,144,149 (GRCm38) missense probably damaging 0.98
R5910:Itpr2 UTSW 6 146,329,571 (GRCm38) missense probably benign 0.10
R5911:Itpr2 UTSW 6 146,312,943 (GRCm38) missense probably benign 0.42
R6044:Itpr2 UTSW 6 146,396,951 (GRCm38) missense probably null 0.98
R6072:Itpr2 UTSW 6 146,347,111 (GRCm38) missense probably damaging 0.98
R6191:Itpr2 UTSW 6 146,328,335 (GRCm38) missense probably benign 0.01
R6483:Itpr2 UTSW 6 146,112,477 (GRCm38) missense possibly damaging 0.52
R6511:Itpr2 UTSW 6 146,329,727 (GRCm38) missense probably damaging 1.00
R6524:Itpr2 UTSW 6 146,345,211 (GRCm38) missense probably benign 0.01
R6561:Itpr2 UTSW 6 146,234,006 (GRCm38) missense probably damaging 0.98
R6594:Itpr2 UTSW 6 146,190,480 (GRCm38) missense possibly damaging 0.71
R6603:Itpr2 UTSW 6 146,347,171 (GRCm38) missense probably damaging 0.98
R6736:Itpr2 UTSW 6 146,325,170 (GRCm38) missense probably damaging 1.00
R6783:Itpr2 UTSW 6 146,385,873 (GRCm38) critical splice donor site probably null
R6831:Itpr2 UTSW 6 146,112,429 (GRCm38) missense probably damaging 1.00
R6857:Itpr2 UTSW 6 146,397,019 (GRCm38) nonsense probably null
R7103:Itpr2 UTSW 6 146,325,074 (GRCm38) missense probably damaging 1.00
R7111:Itpr2 UTSW 6 146,325,056 (GRCm38) missense probably damaging 1.00
R7126:Itpr2 UTSW 6 146,357,796 (GRCm38) nonsense probably null
R7165:Itpr2 UTSW 6 146,294,091 (GRCm38) missense probably damaging 1.00
R7184:Itpr2 UTSW 6 146,311,087 (GRCm38) missense possibly damaging 0.79
R7249:Itpr2 UTSW 6 146,311,052 (GRCm38) missense probably damaging 1.00
R7292:Itpr2 UTSW 6 146,158,949 (GRCm38) missense possibly damaging 0.95
R7342:Itpr2 UTSW 6 146,327,187 (GRCm38) missense probably damaging 0.98
R7392:Itpr2 UTSW 6 146,359,340 (GRCm38) missense possibly damaging 0.95
R7414:Itpr2 UTSW 6 146,373,208 (GRCm38) missense probably benign 0.06
R7448:Itpr2 UTSW 6 146,329,508 (GRCm38) missense probably damaging 1.00
R7492:Itpr2 UTSW 6 146,390,938 (GRCm38) missense probably damaging 1.00
R7515:Itpr2 UTSW 6 146,327,110 (GRCm38) missense probably damaging 1.00
R7529:Itpr2 UTSW 6 146,194,598 (GRCm38) missense probably damaging 0.98
R7558:Itpr2 UTSW 6 146,390,865 (GRCm38) missense probably damaging 1.00
R7650:Itpr2 UTSW 6 146,233,994 (GRCm38) missense probably benign 0.36
R7678:Itpr2 UTSW 6 146,187,550 (GRCm38) missense probably benign 0.00
R7790:Itpr2 UTSW 6 146,224,776 (GRCm38) missense probably damaging 1.00
R7798:Itpr2 UTSW 6 146,386,015 (GRCm38) missense probably benign 0.06
R7831:Itpr2 UTSW 6 146,291,584 (GRCm38) missense probably benign 0.04
R8023:Itpr2 UTSW 6 146,187,490 (GRCm38) missense probably damaging 0.97
R8046:Itpr2 UTSW 6 146,426,459 (GRCm38) missense probably damaging 0.96
R8236:Itpr2 UTSW 6 146,390,783 (GRCm38) critical splice donor site probably null
R8241:Itpr2 UTSW 6 146,418,515 (GRCm38) missense possibly damaging 0.90
R8245:Itpr2 UTSW 6 146,373,106 (GRCm38) missense probably damaging 0.98
R8324:Itpr2 UTSW 6 146,328,398 (GRCm38) missense probably damaging 0.97
R8339:Itpr2 UTSW 6 146,312,898 (GRCm38) missense probably benign 0.19
R8458:Itpr2 UTSW 6 146,233,966 (GRCm38) missense possibly damaging 0.62
R8506:Itpr2 UTSW 6 146,418,416 (GRCm38) critical splice donor site probably null
R8529:Itpr2 UTSW 6 146,329,553 (GRCm38) missense probably damaging 1.00
R8672:Itpr2 UTSW 6 146,374,518 (GRCm38) missense probably damaging 1.00
R8755:Itpr2 UTSW 6 146,232,428 (GRCm38) missense probably benign
R8816:Itpr2 UTSW 6 146,241,212 (GRCm38) missense probably damaging 0.98
R9160:Itpr2 UTSW 6 146,374,601 (GRCm38) missense probably damaging 1.00
R9273:Itpr2 UTSW 6 146,325,031 (GRCm38) missense probably damaging 1.00
R9284:Itpr2 UTSW 6 146,354,676 (GRCm38) missense probably benign 0.01
R9322:Itpr2 UTSW 6 146,325,089 (GRCm38) missense probably benign 0.19
R9357:Itpr2 UTSW 6 146,359,316 (GRCm38) missense probably damaging 1.00
R9424:Itpr2 UTSW 6 146,311,007 (GRCm38) missense probably damaging 0.98
R9438:Itpr2 UTSW 6 146,166,668 (GRCm38) missense probably benign
R9576:Itpr2 UTSW 6 146,311,007 (GRCm38) missense probably damaging 0.98
V8831:Itpr2 UTSW 6 146,385,882 (GRCm38) missense probably damaging 1.00
X0054:Itpr2 UTSW 6 146,323,236 (GRCm38) missense probably damaging 1.00
X0063:Itpr2 UTSW 6 146,180,353 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGTACGAGGCTTCATCC -3'
(R):5'- ACACTCAGTCGGTGTTGCTG -3'

Sequencing Primer
(F):5'- AGGCTTCATCCCGGGCTTG -3'
(R):5'- GCATTCTCTGCCCTGAGAG -3'
Posted On 2016-10-26