Mutagenetix > Incidental Mutation

Incidental Mutation 'R5579:Arhgef12'

438290

Institutional Source

Beutler Lab

Gene Symbol

Arhgef12

Ensembl Gene

ENSMUSG00000059495

Gene Name

Rho guanine nucleotide exchange factor (GEF) 12

Synonyms

LARG, 2310014B11Rik

MMRRC Submission

043267-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.952) question?

Stock #

R5579 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

42963842-43107239 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 43010193 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 329 (G329R)

Ref Sequence

ENSEMBL: ENSMUSP00000126598 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072767] [ENSMUST00000165665]

AlphaFold

Q8R4H2

Predicted Effect

probably benign
Transcript: ENSMUST00000072767
AA Change: G329R

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000072547
Gene: ENSMUSG00000059495
AA Change: G329R

Domain	Start	End	E-Value	Type
low complexity region	49	64	N/A	INTRINSIC
PDZ	80	148	1.64e-19	SMART
coiled coil region	196	259	N/A	INTRINSIC
low complexity region	293	313	N/A	INTRINSIC
Pfam:RGS-like	368	558	8.6e-87	PFAM
low complexity region	583	596	N/A	INTRINSIC
low complexity region	663	676	N/A	INTRINSIC
low complexity region	721	733	N/A	INTRINSIC
RhoGEF	791	976	6.35e-66	SMART
PH	1020	1134	6.26e-6	SMART
low complexity region	1256	1269	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165665
AA Change: G329R

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000126598
Gene: ENSMUSG00000059495
AA Change: G329R

Domain	Start	End	E-Value	Type
low complexity region	49	64	N/A	INTRINSIC
PDZ	80	148	1.64e-19	SMART
coiled coil region	196	259	N/A	INTRINSIC
low complexity region	293	313	N/A	INTRINSIC
Pfam:RGS-like	369	559	1.6e-88	PFAM
low complexity region	584	597	N/A	INTRINSIC
low complexity region	664	677	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
RhoGEF	792	977	6.35e-66	SMART
PH	1021	1135	6.26e-6	SMART
low complexity region	1257	1270	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 98.9%
20x: 97.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli working through G protein-coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein has been observed to form a myeloid/lymphoid fusion partner in acute myeloid leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to certain vasoconstrictors and resistance to salt-induced hypertension. Mice homozygous for a different knock-out allele exhibit partial prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 114 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810403A07Rik	T	C	3: 88,700,275	S345P	probably benign	Het
6430573F11Rik	T	C	8: 36,512,041	V266A	probably benign	Het
Abca3	G	T	17: 24,376,729	C352F	probably damaging	Het
Abce1	A	T	8: 79,700,586	I237N	possibly damaging	Het
Acrbp	A	G	6: 125,061,099	D421G	probably benign	Het
Adam8	T	A	7: 139,988,984	Y201F	probably benign	Het
Adgrf1	T	A	17: 43,311,064	C731S	probably damaging	Het
AF067063	T	A	13: 119,828,415	M82L	probably benign	Het
Akap8l	A	T	17: 32,321,942	I529N	probably damaging	Het
Akap9	G	A	5: 4,064,714	G114D	possibly damaging	Het
Alox12b	T	A	11: 69,162,932	D158E	probably benign	Het
Ankrd11	A	G	8: 122,884,231	S2639P	probably damaging	Het
Ankrd42	T	C	7: 92,590,182	Y466C	possibly damaging	Het
Apobr	T	C	7: 126,587,675	I786T	probably benign	Het
Btnl1	T	C	17: 34,381,552		probably null	Het
Ccdc174	A	G	6: 91,881,350		probably null	Het
Ccdc183	T	C	2: 25,615,422	D177G	possibly damaging	Het
Cd14	A	G	18: 36,726,235	Y56H	probably benign	Het
Cep162	G	A	9: 87,203,671	A1200V	probably benign	Het
Clic3	T	C	2: 25,458,307	L128P	probably damaging	Het
Cntnap5b	A	T	1: 100,383,395	R538*	probably null	Het
Cntnap5b	A	T	1: 100,383,399	Q539L	probably benign	Het
Coq7	A	T	7: 118,517,335	N214K	unknown	Het
Cramp1l	G	A	17: 24,973,113	H1018Y	possibly damaging	Het
Crtac1	T	A	19: 42,304,806	D288V	probably damaging	Het
Dab2ip	C	T	2: 35,715,327	R132*	probably null	Het
Dis3l	C	A	9: 64,330,835	C125F	probably benign	Het
Dnmt1	A	T	9: 20,920,205	V543D	probably damaging	Het
Dock9	A	T	14: 121,599,695	L67Q	probably damaging	Het
Ehbp1	A	T	11: 22,137,846	S413T	probably damaging	Het
Endov	A	G	11: 119,505,097	I158V	probably benign	Het
Epb41l4b	A	G	4: 57,064,802	V469A	possibly damaging	Het
Etf1	G	A	18: 34,913,601	P119S	probably damaging	Het
Fam135a	A	G	1: 24,029,727	L491P	possibly damaging	Het
Fancd2	A	T	6: 113,560,051		probably null	Het
Fank1	T	A	7: 133,869,329		probably null	Het
Fbxo18	A	G	2: 11,748,993	I846T	probably damaging	Het
Gas2l3	T	C	10: 89,414,066	T397A	probably benign	Het
Gga1	T	C	15: 78,893,188	V513A	probably damaging	Het
Ggt1	T	C	10: 75,585,948	V543A	probably damaging	Het
Gm11596	A	T	11: 99,792,891	C134*	probably null	Het
Gnal	C	T	18: 67,088,771	R82C	unknown	Het
Hat1	T	C	2: 71,410,238	V92A	possibly damaging	Het
Icosl	C	T	10: 78,073,763	R181C	probably damaging	Het
Ift46	A	G	9: 44,786,863	M208V	possibly damaging	Het
Ighv1-26	T	C	12: 114,788,599	K42E	possibly damaging	Het
Ipo5	A	G	14: 120,938,613	K617E	probably benign	Het
Irx5	A	G	8: 92,359,913	D208G	probably benign	Het
Itgal	T	G	7: 127,306,929	V397G	probably benign	Het
Itpr2	G	A	6: 146,173,366	R2297*	probably null	Het
Itpr3	A	G	17: 27,113,519	D1779G	probably damaging	Het
Krt4	T	A	15: 101,921,234	E286D	probably benign	Het
Loxl4	C	T	19: 42,604,290	G317E	probably damaging	Het
Mapk6	T	G	9: 75,388,062	H718P	possibly damaging	Het
Mark2	A	C	19: 7,282,816	V14G	probably damaging	Het
Mbd5	A	G	2: 49,272,814	T1103A	possibly damaging	Het
Mcph1	A	G	8: 18,632,293	E482G	probably benign	Het
Mme	G	A	3: 63,348,645	E509K	probably damaging	Het
Mrgbp	A	G	2: 180,585,483	T204A	probably damaging	Het
Mycbp2	A	T	14: 103,291,333	F430I	probably damaging	Het
Myo6	A	G	9: 80,217,720	D27G	probably damaging	Het
Ncoa6	A	G	2: 155,406,677	L1569S	probably damaging	Het
Ndc1	T	A	4: 107,380,704	F235Y	possibly damaging	Het
Nmur2	A	T	11: 56,033,009	S240T	probably benign	Het
Olfr1176	A	T	2: 88,340,413	I283F	possibly damaging	Het
Olfr301	T	A	7: 86,412,726	Y121*	probably null	Het
Olfr608	G	A	7: 103,470,914	V292M	probably damaging	Het
Osbpl1a	A	C	18: 12,892,262	S333A	probably benign	Het
Osbpl1a	G	T	18: 12,841,192	A62E	probably damaging	Het
Otud4	C	T	8: 79,664,108	T417I	probably benign	Het
Pagr1a	T	C	7: 127,015,442	E197G	probably damaging	Het
Pcdh18	T	C	3: 49,744,977	Q1012R	probably damaging	Het
Pcdhgb5	A	C	18: 37,731,637	I162L	probably benign	Het
Pdpr	T	A	8: 111,123,816	Y462N	probably damaging	Het
Pkhd1	A	T	1: 20,523,142	H1582Q	probably damaging	Het
Polr1b	A	G	2: 129,110,108	K352R	probably damaging	Het
Poteg	G	A	8: 27,448,037	V12M	probably damaging	Het
Pou2f1	A	C	1: 165,915,162	V54G	probably damaging	Het
Ppme1	A	G	7: 100,344,975	L177P	probably damaging	Het
Prkce	A	G	17: 86,619,948	D550G	probably damaging	Het
Prrc2c	A	G	1: 162,680,758		probably null	Het
Ptpn22	A	G	3: 103,882,139		probably null	Het
Rabif	G	A	1: 134,506,205	V86M	probably damaging	Het
Rbm25	T	A	12: 83,668,507	M484K	probably benign	Het
Rcn2	G	A	9: 56,057,429	A224T	probably benign	Het
Rexo5	T	A	7: 119,834,403		probably null	Het
Rnase1	A	T	14: 51,145,762	I45N	probably benign	Het
Rnmt	T	A	18: 68,306,115	D98E	possibly damaging	Het
Rprd2	A	G	3: 95,785,059	F188L	probably damaging	Het
Scube2	G	A	7: 109,810,737	T643M	probably damaging	Het
Slc7a15	T	C	12: 8,539,344	I68V	probably benign	Het
Slco1a5	A	T	6: 142,242,125	V496D	possibly damaging	Het
Slitrk6	T	G	14: 110,751,217	S353R	possibly damaging	Het
Smpd5	T	A	15: 76,295,125	I53K	possibly damaging	Het
Tas2r108	T	C	6: 40,494,087	S166P	probably benign	Het
Tecpr1	C	A	5: 144,214,344	V245L	possibly damaging	Het
Tenm3	G	T	8: 48,236,764	N1929K	probably damaging	Het
Tigd5	T	G	15: 75,911,025	F412C	probably damaging	Het
Timm17a	A	T	1: 135,306,188	S74T	possibly damaging	Het
Tle1	A	T	4: 72,139,808	L60Q	probably damaging	Het
Tmem132d	T	C	5: 127,796,000	E515G	possibly damaging	Het
Tmem65	T	C	15: 58,794,397	N115S	probably benign	Het
Trmt5	C	A	12: 73,281,652	R259L	possibly damaging	Het
Ttc37	T	C	13: 76,185,200	W25R	probably damaging	Het
Vmn2r50	A	T	7: 10,050,089	W153R	probably benign	Het
Vwa3a	T	G	7: 120,768,173	S184A	probably benign	Het
Zbtb25	A	G	12: 76,349,164	L428P	possibly damaging	Het
Zbtb49	C	T	5: 38,200,816	D698N	probably damaging	Het
Zbtb8os	T	G	4: 129,340,735	D35E	probably damaging	Het
Zfp316	T	C	5: 143,264,491	T56A	unknown	Het
Zfp334	A	T	2: 165,380,487	C545*	probably null	Het
Zmiz1	C	A	14: 25,644,856	S247R	probably damaging	Het
Zscan18	A	G	7: 12,775,381		probably benign	Het
Zzef1	T	C	11: 72,900,637	V2189A	probably damaging	Het

Other mutations in Arhgef12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00923:Arhgef12	APN	9	43,020,624 (GRCm38)	missense	probably damaging	1.00
IGL00942:Arhgef12	APN	9	42,982,000 (GRCm38)	missense	probably damaging	1.00
IGL01529:Arhgef12	APN	9	42,990,055 (GRCm38)	missense	probably damaging	1.00
IGL01845:Arhgef12	APN	9	43,022,841 (GRCm38)	missense	possibly damaging	0.56
IGL02039:Arhgef12	APN	9	42,972,267 (GRCm38)	missense	probably benign
IGL02135:Arhgef12	APN	9	42,972,165 (GRCm38)	missense	possibly damaging	0.68
IGL02272:Arhgef12	APN	9	43,001,452 (GRCm38)	missense	probably damaging	1.00
IGL02498:Arhgef12	APN	9	42,982,043 (GRCm38)	missense	probably benign	0.19
IGL02507:Arhgef12	APN	9	42,992,563 (GRCm38)	missense	probably damaging	1.00
IGL02574:Arhgef12	APN	9	43,005,623 (GRCm38)	missense	probably damaging	0.99
IGL02586:Arhgef12	APN	9	43,005,904 (GRCm38)	nonsense	probably null
IGL02803:Arhgef12	APN	9	42,972,028 (GRCm38)	missense	possibly damaging	0.48
IGL02892:Arhgef12	APN	9	43,000,972 (GRCm38)	missense	possibly damaging	0.79
IGL02937:Arhgef12	APN	9	43,015,920 (GRCm38)	missense	probably damaging	0.97
IGL02992:Arhgef12	APN	9	42,999,077 (GRCm38)	missense	probably damaging	1.00
IGL03028:Arhgef12	APN	9	43,026,228 (GRCm38)	missense	possibly damaging	0.84
IGL03146:Arhgef12	APN	9	42,974,570 (GRCm38)	missense	possibly damaging	0.90
IGL03193:Arhgef12	APN	9	42,992,533 (GRCm38)	splice site	probably benign
IGL03398:Arhgef12	APN	9	42,978,226 (GRCm38)	missense	probably damaging	1.00
R0019:Arhgef12	UTSW	9	42,978,233 (GRCm38)	missense	probably damaging	1.00
R0143:Arhgef12	UTSW	9	43,005,594 (GRCm38)	missense	probably damaging	1.00
R0211:Arhgef12	UTSW	9	42,972,004 (GRCm38)	missense	probably damaging	0.97
R0330:Arhgef12	UTSW	9	43,020,686 (GRCm38)	missense	probably damaging	0.97
R0364:Arhgef12	UTSW	9	43,018,401 (GRCm38)	missense	probably damaging	0.99
R0426:Arhgef12	UTSW	9	42,970,990 (GRCm38)	splice site	probably null
R0658:Arhgef12	UTSW	9	42,981,985 (GRCm38)	missense	probably damaging	1.00
R0686:Arhgef12	UTSW	9	42,993,028 (GRCm38)	missense	probably benign	0.02
R0693:Arhgef12	UTSW	9	43,018,401 (GRCm38)	missense	probably damaging	0.99
R0990:Arhgef12	UTSW	9	42,972,381 (GRCm38)	missense	probably benign	0.00
R1147:Arhgef12	UTSW	9	43,044,256 (GRCm38)	unclassified	probably benign
R1395:Arhgef12	UTSW	9	43,005,870 (GRCm38)	missense	probably damaging	1.00
R1419:Arhgef12	UTSW	9	43,027,220 (GRCm38)	missense	probably damaging	1.00
R1451:Arhgef12	UTSW	9	42,992,578 (GRCm38)	splice site	probably benign
R1458:Arhgef12	UTSW	9	42,988,998 (GRCm38)	missense	probably damaging	0.98
R1654:Arhgef12	UTSW	9	42,997,660 (GRCm38)	missense	possibly damaging	0.83
R1722:Arhgef12	UTSW	9	43,020,717 (GRCm38)	makesense	probably null
R1773:Arhgef12	UTSW	9	43,005,542 (GRCm38)	critical splice donor site	probably null
R1895:Arhgef12	UTSW	9	43,005,856 (GRCm38)	missense	probably damaging	1.00
R2109:Arhgef12	UTSW	9	42,979,472 (GRCm38)	missense	possibly damaging	0.75
R2215:Arhgef12	UTSW	9	43,005,871 (GRCm38)	missense	probably damaging	1.00
R2421:Arhgef12	UTSW	9	43,001,006 (GRCm38)	missense	probably damaging	1.00
R3967:Arhgef12	UTSW	9	43,005,551 (GRCm38)	missense	probably damaging	1.00
R3968:Arhgef12	UTSW	9	43,005,551 (GRCm38)	missense	probably damaging	1.00
R3969:Arhgef12	UTSW	9	43,005,551 (GRCm38)	missense	probably damaging	1.00
R4077:Arhgef12	UTSW	9	42,975,292 (GRCm38)	missense	probably damaging	0.99
R4079:Arhgef12	UTSW	9	42,975,292 (GRCm38)	missense	probably damaging	0.99
R4111:Arhgef12	UTSW	9	42,972,274 (GRCm38)	missense	probably damaging	1.00
R4302:Arhgef12	UTSW	9	43,018,349 (GRCm38)	nonsense	probably null
R4327:Arhgef12	UTSW	9	42,975,229 (GRCm38)	nonsense	probably null
R4462:Arhgef12	UTSW	9	42,981,982 (GRCm38)	missense	probably damaging	1.00
R4583:Arhgef12	UTSW	9	42,977,662 (GRCm38)	missense	probably damaging	1.00
R4603:Arhgef12	UTSW	9	43,010,193 (GRCm38)	missense	probably benign	0.27
R4650:Arhgef12	UTSW	9	42,981,970 (GRCm38)	missense	probably damaging	1.00
R4741:Arhgef12	UTSW	9	42,972,153 (GRCm38)	missense	possibly damaging	0.54
R4823:Arhgef12	UTSW	9	43,020,696 (GRCm38)	missense	probably benign
R4840:Arhgef12	UTSW	9	42,975,068 (GRCm38)	missense	probably benign	0.04
R4912:Arhgef12	UTSW	9	42,993,065 (GRCm38)	nonsense	probably null
R5176:Arhgef12	UTSW	9	43,020,686 (GRCm38)	missense	probably damaging	0.97
R5426:Arhgef12	UTSW	9	42,986,584 (GRCm38)	missense	probably damaging	1.00
R5838:Arhgef12	UTSW	9	43,005,608 (GRCm38)	missense	probably damaging	1.00
R6230:Arhgef12	UTSW	9	42,988,965 (GRCm38)	missense	probably benign	0.04
R6741:Arhgef12	UTSW	9	42,972,207 (GRCm38)	missense	probably benign	0.05
R6959:Arhgef12	UTSW	9	43,015,953 (GRCm38)	missense	probably benign
R7252:Arhgef12	UTSW	9	43,015,909 (GRCm38)	missense	probably benign	0.17
R7470:Arhgef12	UTSW	9	43,040,552 (GRCm38)	missense	probably damaging	1.00
R7658:Arhgef12	UTSW	9	42,992,536 (GRCm38)	missense	probably damaging	1.00
R7724:Arhgef12	UTSW	9	43,027,271 (GRCm38)	missense	probably damaging	1.00
R7980:Arhgef12	UTSW	9	42,971,299 (GRCm38)	nonsense	probably null
R8074:Arhgef12	UTSW	9	42,971,103 (GRCm38)	nonsense	probably null
R8155:Arhgef12	UTSW	9	43,042,662 (GRCm38)	missense	probably damaging	1.00
R8270:Arhgef12	UTSW	9	42,971,058 (GRCm38)	missense	probably benign
R8407:Arhgef12	UTSW	9	43,026,179 (GRCm38)	critical splice donor site	probably null
R8527:Arhgef12	UTSW	9	42,997,648 (GRCm38)	missense	possibly damaging	0.95
R9116:Arhgef12	UTSW	9	42,981,945 (GRCm38)	splice site	probably benign
R9127:Arhgef12	UTSW	9	42,974,574 (GRCm38)	missense	possibly damaging	0.94
R9602:Arhgef12	UTSW	9	42,984,380 (GRCm38)	missense	probably damaging	1.00
R9665:Arhgef12	UTSW	9	43,018,354 (GRCm38)	missense	possibly damaging	0.89
R9733:Arhgef12	UTSW	9	42,989,998 (GRCm38)	nonsense	probably null
R9735:Arhgef12	UTSW	9	42,971,103 (GRCm38)	nonsense	probably null
R9760:Arhgef12	UTSW	9	42,992,022 (GRCm38)	missense	probably damaging	1.00
RF020:Arhgef12	UTSW	9	42,989,989 (GRCm38)	missense	possibly damaging	0.75
Z1176:Arhgef12	UTSW	9	42,971,072 (GRCm38)	missense	probably benign	0.00
Z1186:Arhgef12	UTSW	9	43,000,015 (GRCm38)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAGACAGCATGTGAGATCC -3'
(R):5'- TCAGTGTGATGTGGAGAAGC -3'

Sequencing Primer
(F):5'- GACAGCATGTGAGATCCTCCTAG -3'
(R):5'- CAGGTGACACCACTTAGGATATG -3'

Posted On

2016-10-26