Incidental Mutation 'R5579:Nmur2'
ID 438301
Institutional Source Beutler Lab
Gene Symbol Nmur2
Ensembl Gene ENSMUSG00000037393
Gene Name neuromedin U receptor 2
Synonyms
MMRRC Submission 043267-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.211) question?
Stock # R5579 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 55915816-55931813 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 55923835 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 240 (S240T)
Ref Sequence ENSEMBL: ENSMUSP00000044718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037682]
AlphaFold Q8BZ39
Predicted Effect probably benign
Transcript: ENSMUST00000037682
AA Change: S240T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000044718
Gene: ENSMUSG00000037393
AA Change: S240T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srw 42 337 4.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 48 334 1.8e-13 PFAM
Pfam:7tm_1 54 319 5.7e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134285
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein from the G-protein coupled receptor 1 family. This protein is a receptor for neuromedin U, which is a neuropeptide that is widely distributed in the gut and central nervous system. This receptor plays an important role in the regulation of food intake and body weight. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit increased chemical and thermal nociception thresholds, insensitivity to treatment with Nmu or Nms, and altered weight gain following a fast or when fed a high-fat diet that can be sex-dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G T 17: 24,595,703 (GRCm39) C352F probably damaging Het
Abce1 A T 8: 80,427,215 (GRCm39) I237N possibly damaging Het
Acrbp A G 6: 125,038,062 (GRCm39) D421G probably benign Het
Adam8 T A 7: 139,568,897 (GRCm39) Y201F probably benign Het
Adgrf1 T A 17: 43,621,955 (GRCm39) C731S probably damaging Het
Akap8l A T 17: 32,540,916 (GRCm39) I529N probably damaging Het
Akap9 G A 5: 4,114,714 (GRCm39) G114D possibly damaging Het
Alox12b T A 11: 69,053,758 (GRCm39) D158E probably benign Het
Ankrd11 A G 8: 123,610,970 (GRCm39) S2639P probably damaging Het
Ankrd42 T C 7: 92,239,390 (GRCm39) Y466C possibly damaging Het
Apobr T C 7: 126,186,847 (GRCm39) I786T probably benign Het
Arhgef12 C T 9: 42,921,489 (GRCm39) G329R probably benign Het
Btnl1 T C 17: 34,600,526 (GRCm39) probably null Het
Ccdc174 A G 6: 91,858,331 (GRCm39) probably null Het
Ccdc183 T C 2: 25,505,434 (GRCm39) D177G possibly damaging Het
Cd14 A G 18: 36,859,288 (GRCm39) Y56H probably benign Het
Cep162 G A 9: 87,085,724 (GRCm39) A1200V probably benign Het
Clic3 T C 2: 25,348,319 (GRCm39) L128P probably damaging Het
Cntnap5b A T 1: 100,311,120 (GRCm39) R538* probably null Het
Cntnap5b A T 1: 100,311,124 (GRCm39) Q539L probably benign Het
Coq7 A T 7: 118,116,558 (GRCm39) N214K unknown Het
Cramp1 G A 17: 25,192,087 (GRCm39) H1018Y possibly damaging Het
Crtac1 T A 19: 42,293,245 (GRCm39) D288V probably damaging Het
Dab2ip C T 2: 35,605,339 (GRCm39) R132* probably null Het
Dis3l C A 9: 64,238,117 (GRCm39) C125F probably benign Het
Dnmt1 A T 9: 20,831,501 (GRCm39) V543D probably damaging Het
Dock9 A T 14: 121,837,107 (GRCm39) L67Q probably damaging Het
Ehbp1 A T 11: 22,087,846 (GRCm39) S413T probably damaging Het
Endov A G 11: 119,395,923 (GRCm39) I158V probably benign Het
Epb41l4b A G 4: 57,064,802 (GRCm39) V469A possibly damaging Het
Etf1 G A 18: 35,046,654 (GRCm39) P119S probably damaging Het
Fam135a A G 1: 24,068,808 (GRCm39) L491P possibly damaging Het
Fancd2 A T 6: 113,537,012 (GRCm39) probably null Het
Fank1 T A 7: 133,471,058 (GRCm39) probably null Het
Fbh1 A G 2: 11,753,804 (GRCm39) I846T probably damaging Het
Gas2l3 T C 10: 89,249,928 (GRCm39) T397A probably benign Het
Gga1 T C 15: 78,777,388 (GRCm39) V513A probably damaging Het
Ggt1 T C 10: 75,421,782 (GRCm39) V543A probably damaging Het
Gm11596 A T 11: 99,683,717 (GRCm39) C134* probably null Het
Gnal C T 18: 67,221,842 (GRCm39) R82C unknown Het
Hat1 T C 2: 71,240,582 (GRCm39) V92A possibly damaging Het
Icosl C T 10: 77,909,597 (GRCm39) R181C probably damaging Het
Ift46 A G 9: 44,698,160 (GRCm39) M208V possibly damaging Het
Ighv1-26 T C 12: 114,752,219 (GRCm39) K42E possibly damaging Het
Ipo5 A G 14: 121,176,025 (GRCm39) K617E probably benign Het
Irx5 A G 8: 93,086,541 (GRCm39) D208G probably benign Het
Itgal T G 7: 126,906,101 (GRCm39) V397G probably benign Het
Itpr2 G A 6: 146,074,864 (GRCm39) R2297* probably null Het
Itpr3 A G 17: 27,332,493 (GRCm39) D1779G probably damaging Het
Khdc4 T C 3: 88,607,582 (GRCm39) S345P probably benign Het
Krt4 T A 15: 101,829,669 (GRCm39) E286D probably benign Het
Loxl4 C T 19: 42,592,729 (GRCm39) G317E probably damaging Het
Mapk6 T G 9: 75,295,344 (GRCm39) H718P possibly damaging Het
Mark2 A C 19: 7,260,181 (GRCm39) V14G probably damaging Het
Mbd5 A G 2: 49,162,826 (GRCm39) T1103A possibly damaging Het
Mcph1 A G 8: 18,682,309 (GRCm39) E482G probably benign Het
Mme G A 3: 63,256,066 (GRCm39) E509K probably damaging Het
Mrgbp A G 2: 180,227,276 (GRCm39) T204A probably damaging Het
Mycbp2 A T 14: 103,528,769 (GRCm39) F430I probably damaging Het
Myo6 A G 9: 80,125,002 (GRCm39) D27G probably damaging Het
Ncoa6 A G 2: 155,248,597 (GRCm39) L1569S probably damaging Het
Ndc1 T A 4: 107,237,901 (GRCm39) F235Y possibly damaging Het
Or14c44 T A 7: 86,061,934 (GRCm39) Y121* probably null Het
Or52ae7 G A 7: 103,120,121 (GRCm39) V292M probably damaging Het
Or5d46 A T 2: 88,170,757 (GRCm39) I283F possibly damaging Het
Osbpl1a G T 18: 12,974,249 (GRCm39) A62E probably damaging Het
Osbpl1a A C 18: 13,025,319 (GRCm39) S333A probably benign Het
Otud4 C T 8: 80,390,737 (GRCm39) T417I probably benign Het
Pagr1a T C 7: 126,614,614 (GRCm39) E197G probably damaging Het
Pcdh18 T C 3: 49,699,426 (GRCm39) Q1012R probably damaging Het
Pcdhgb5 A C 18: 37,864,690 (GRCm39) I162L probably benign Het
Pdpr T A 8: 111,850,448 (GRCm39) Y462N probably damaging Het
Pkhd1 A T 1: 20,593,366 (GRCm39) H1582Q probably damaging Het
Polr1b A G 2: 128,952,028 (GRCm39) K352R probably damaging Het
Poteg G A 8: 27,938,065 (GRCm39) V12M probably damaging Het
Pou2f1 A C 1: 165,742,731 (GRCm39) V54G probably damaging Het
Ppme1 A G 7: 99,994,182 (GRCm39) L177P probably damaging Het
Prkce A G 17: 86,927,376 (GRCm39) D550G probably damaging Het
Prrc2c A G 1: 162,508,327 (GRCm39) probably null Het
Ptpn22 A G 3: 103,789,455 (GRCm39) probably null Het
Rabif G A 1: 134,433,943 (GRCm39) V86M probably damaging Het
Rbm25 T A 12: 83,715,281 (GRCm39) M484K probably benign Het
Rcn2 G A 9: 55,964,713 (GRCm39) A224T probably benign Het
Rexo5 T A 7: 119,433,626 (GRCm39) probably null Het
Rnase1 A T 14: 51,383,219 (GRCm39) I45N probably benign Het
Rnmt T A 18: 68,439,186 (GRCm39) D98E possibly damaging Het
Rprd2 A G 3: 95,692,371 (GRCm39) F188L probably damaging Het
Scube2 G A 7: 109,409,944 (GRCm39) T643M probably damaging Het
Skic3 T C 13: 76,333,319 (GRCm39) W25R probably damaging Het
Slc7a15 T C 12: 8,589,344 (GRCm39) I68V probably benign Het
Slco1a5 A T 6: 142,187,851 (GRCm39) V496D possibly damaging Het
Slitrk6 T G 14: 110,988,649 (GRCm39) S353R possibly damaging Het
Smpd5 T A 15: 76,179,325 (GRCm39) I53K possibly damaging Het
Tas2r108 T C 6: 40,471,021 (GRCm39) S166P probably benign Het
Tcstv7a T A 13: 120,289,951 (GRCm39) M82L probably benign Het
Tecpr1 C A 5: 144,151,162 (GRCm39) V245L possibly damaging Het
Tenm3 G T 8: 48,689,799 (GRCm39) N1929K probably damaging Het
Tigd5 T G 15: 75,782,874 (GRCm39) F412C probably damaging Het
Timm17a A T 1: 135,233,926 (GRCm39) S74T possibly damaging Het
Tle1 A T 4: 72,058,045 (GRCm39) L60Q probably damaging Het
Tmem132d T C 5: 127,873,064 (GRCm39) E515G possibly damaging Het
Tmem65 T C 15: 58,666,246 (GRCm39) N115S probably benign Het
Trmt5 C A 12: 73,328,426 (GRCm39) R259L possibly damaging Het
Trmt9b T C 8: 36,979,195 (GRCm39) V266A probably benign Het
Vmn2r50 A T 7: 9,784,016 (GRCm39) W153R probably benign Het
Vwa3a T G 7: 120,367,396 (GRCm39) S184A probably benign Het
Zbtb25 A G 12: 76,395,938 (GRCm39) L428P possibly damaging Het
Zbtb49 C T 5: 38,358,160 (GRCm39) D698N probably damaging Het
Zbtb8os T G 4: 129,234,528 (GRCm39) D35E probably damaging Het
Zfp316 T C 5: 143,250,246 (GRCm39) T56A unknown Het
Zfp334 A T 2: 165,222,407 (GRCm39) C545* probably null Het
Zmiz1 C A 14: 25,645,280 (GRCm39) S247R probably damaging Het
Zscan18 A G 7: 12,509,308 (GRCm39) probably benign Het
Zzef1 T C 11: 72,791,463 (GRCm39) V2189A probably damaging Het
Other mutations in Nmur2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Nmur2 APN 11 55,931,603 (GRCm39) missense probably damaging 0.99
IGL01591:Nmur2 APN 11 55,917,825 (GRCm39) missense probably benign
IGL01960:Nmur2 APN 11 55,931,337 (GRCm39) missense probably damaging 0.99
IGL02108:Nmur2 APN 11 55,931,190 (GRCm39) missense probably benign 0.33
IGL02602:Nmur2 APN 11 55,917,889 (GRCm39) missense probably benign 0.19
PIT4677001:Nmur2 UTSW 11 55,923,835 (GRCm39) missense probably benign 0.00
R0324:Nmur2 UTSW 11 55,931,346 (GRCm39) missense probably damaging 1.00
R0458:Nmur2 UTSW 11 55,931,394 (GRCm39) missense possibly damaging 0.93
R0718:Nmur2 UTSW 11 55,920,324 (GRCm39) splice site probably benign
R1799:Nmur2 UTSW 11 55,920,447 (GRCm39) missense probably damaging 1.00
R2099:Nmur2 UTSW 11 55,931,589 (GRCm39) missense probably benign 0.00
R2263:Nmur2 UTSW 11 55,920,387 (GRCm39) missense probably damaging 0.97
R3701:Nmur2 UTSW 11 55,931,603 (GRCm39) missense probably damaging 0.99
R3705:Nmur2 UTSW 11 55,931,300 (GRCm39) missense probably damaging 1.00
R3951:Nmur2 UTSW 11 55,931,051 (GRCm39) missense probably damaging 1.00
R4083:Nmur2 UTSW 11 55,931,051 (GRCm39) missense probably damaging 1.00
R4744:Nmur2 UTSW 11 55,931,661 (GRCm39) missense probably benign 0.01
R4747:Nmur2 UTSW 11 55,931,105 (GRCm39) missense probably benign 0.05
R5288:Nmur2 UTSW 11 55,931,040 (GRCm39) missense probably damaging 1.00
R5384:Nmur2 UTSW 11 55,931,040 (GRCm39) missense probably damaging 1.00
R6329:Nmur2 UTSW 11 55,920,411 (GRCm39) missense probably benign 0.30
R6477:Nmur2 UTSW 11 55,920,417 (GRCm39) missense probably damaging 1.00
R7445:Nmur2 UTSW 11 55,923,766 (GRCm39) missense probably damaging 0.97
R7580:Nmur2 UTSW 11 55,917,808 (GRCm39) missense probably benign 0.03
R7899:Nmur2 UTSW 11 55,931,161 (GRCm39) missense probably benign
R8688:Nmur2 UTSW 11 55,931,654 (GRCm39) missense probably damaging 1.00
R9090:Nmur2 UTSW 11 55,931,308 (GRCm39) missense probably benign 0.44
R9098:Nmur2 UTSW 11 55,920,408 (GRCm39) missense possibly damaging 0.93
R9271:Nmur2 UTSW 11 55,931,308 (GRCm39) missense probably benign 0.44
R9542:Nmur2 UTSW 11 55,931,649 (GRCm39) missense probably damaging 0.98
X0062:Nmur2 UTSW 11 55,931,675 (GRCm39) missense probably benign 0.01
Z1176:Nmur2 UTSW 11 55,917,927 (GRCm39) missense probably benign 0.12
Z1186:Nmur2 UTSW 11 55,931,104 (GRCm39) missense probably benign
Z1187:Nmur2 UTSW 11 55,931,104 (GRCm39) missense probably benign
Z1188:Nmur2 UTSW 11 55,931,104 (GRCm39) missense probably benign
Z1189:Nmur2 UTSW 11 55,931,104 (GRCm39) missense probably benign
Z1190:Nmur2 UTSW 11 55,931,104 (GRCm39) missense probably benign
Z1191:Nmur2 UTSW 11 55,931,104 (GRCm39) missense probably benign
Z1192:Nmur2 UTSW 11 55,931,104 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCAGCACCATTACGTCAG -3'
(R):5'- ACCCTATCCAGAGAACTTAGACTG -3'

Sequencing Primer
(F):5'- GCACCATTACGTCAGTACCAAAG -3'
(R):5'- GACTGAATTCTGCCTCCAGTGAAG -3'
Posted On 2016-10-26