Incidental Mutation 'R5579:Zzef1'
ID438303
Institutional Source Beutler Lab
Gene Symbol Zzef1
Ensembl Gene ENSMUSG00000055670
Gene Namezinc finger, ZZ-type with EF hand domain 1
SynonymsC130099L13Rik, 8430405D05Rik
MMRRC Submission 043267-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5579 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location72796226-72927120 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72900637 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 2189 (V2189A)
Ref Sequence ENSEMBL: ENSMUSP00000147028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069395] [ENSMUST00000172220] [ENSMUST00000207107]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069395
AA Change: V2160A

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068790
Gene: ENSMUSG00000055670
AA Change: V2160A

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1122 1192 1.25e-7 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2657 2726 1.25e-7 PROSPERO
low complexity region 2840 2853 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172220
AA Change: V2160A

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130515
Gene: ENSMUSG00000055670
AA Change: V2160A

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1006 1192 1.57e-16 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2583 2759 1.57e-16 PROSPERO
low complexity region 2873 2886 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207107
AA Change: V2189A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,700,275 S345P probably benign Het
6430573F11Rik T C 8: 36,512,041 V266A probably benign Het
Abca3 G T 17: 24,376,729 C352F probably damaging Het
Abce1 A T 8: 79,700,586 I237N possibly damaging Het
Acrbp A G 6: 125,061,099 D421G probably benign Het
Adam8 T A 7: 139,988,984 Y201F probably benign Het
Adgrf1 T A 17: 43,311,064 C731S probably damaging Het
AF067063 T A 13: 119,828,415 M82L probably benign Het
Akap8l A T 17: 32,321,942 I529N probably damaging Het
Akap9 G A 5: 4,064,714 G114D possibly damaging Het
Alox12b T A 11: 69,162,932 D158E probably benign Het
Ankrd11 A G 8: 122,884,231 S2639P probably damaging Het
Ankrd42 T C 7: 92,590,182 Y466C possibly damaging Het
Apobr T C 7: 126,587,675 I786T probably benign Het
Arhgef12 C T 9: 43,010,193 G329R probably benign Het
Btnl1 T C 17: 34,381,552 probably null Het
Ccdc174 A G 6: 91,881,350 probably null Het
Ccdc183 T C 2: 25,615,422 D177G possibly damaging Het
Cd14 A G 18: 36,726,235 Y56H probably benign Het
Cep162 G A 9: 87,203,671 A1200V probably benign Het
Clic3 T C 2: 25,458,307 L128P probably damaging Het
Cntnap5b A T 1: 100,383,399 Q539L probably benign Het
Cntnap5b A T 1: 100,383,395 R538* probably null Het
Coq7 A T 7: 118,517,335 N214K unknown Het
Cramp1l G A 17: 24,973,113 H1018Y possibly damaging Het
Crtac1 T A 19: 42,304,806 D288V probably damaging Het
Dab2ip C T 2: 35,715,327 R132* probably null Het
Dis3l C A 9: 64,330,835 C125F probably benign Het
Dnmt1 A T 9: 20,920,205 V543D probably damaging Het
Dock9 A T 14: 121,599,695 L67Q probably damaging Het
Ehbp1 A T 11: 22,137,846 S413T probably damaging Het
Endov A G 11: 119,505,097 I158V probably benign Het
Epb41l4b A G 4: 57,064,802 V469A possibly damaging Het
Etf1 G A 18: 34,913,601 P119S probably damaging Het
Fam135a A G 1: 24,029,727 L491P possibly damaging Het
Fancd2 A T 6: 113,560,051 probably null Het
Fank1 T A 7: 133,869,329 probably null Het
Fbxo18 A G 2: 11,748,993 I846T probably damaging Het
Gas2l3 T C 10: 89,414,066 T397A probably benign Het
Gga1 T C 15: 78,893,188 V513A probably damaging Het
Ggt1 T C 10: 75,585,948 V543A probably damaging Het
Gm11596 A T 11: 99,792,891 C134* probably null Het
Gnal C T 18: 67,088,771 R82C unknown Het
Hat1 T C 2: 71,410,238 V92A possibly damaging Het
Icosl C T 10: 78,073,763 R181C probably damaging Het
Ift46 A G 9: 44,786,863 M208V possibly damaging Het
Ighv1-26 T C 12: 114,788,599 K42E possibly damaging Het
Ipo5 A G 14: 120,938,613 K617E probably benign Het
Irx5 A G 8: 92,359,913 D208G probably benign Het
Itgal T G 7: 127,306,929 V397G probably benign Het
Itpr2 G A 6: 146,173,366 R2297* probably null Het
Itpr3 A G 17: 27,113,519 D1779G probably damaging Het
Krt4 T A 15: 101,921,234 E286D probably benign Het
Loxl4 C T 19: 42,604,290 G317E probably damaging Het
Mapk6 T G 9: 75,388,062 H718P possibly damaging Het
Mark2 A C 19: 7,282,816 V14G probably damaging Het
Mbd5 A G 2: 49,272,814 T1103A possibly damaging Het
Mcph1 A G 8: 18,632,293 E482G probably benign Het
Mme G A 3: 63,348,645 E509K probably damaging Het
Mrgbp A G 2: 180,585,483 T204A probably damaging Het
Mycbp2 A T 14: 103,291,333 F430I probably damaging Het
Myo6 A G 9: 80,217,720 D27G probably damaging Het
Ncoa6 A G 2: 155,406,677 L1569S probably damaging Het
Ndc1 T A 4: 107,380,704 F235Y possibly damaging Het
Nmur2 A T 11: 56,033,009 S240T probably benign Het
Olfr1176 A T 2: 88,340,413 I283F possibly damaging Het
Olfr301 T A 7: 86,412,726 Y121* probably null Het
Olfr608 G A 7: 103,470,914 V292M probably damaging Het
Osbpl1a G T 18: 12,841,192 A62E probably damaging Het
Osbpl1a A C 18: 12,892,262 S333A probably benign Het
Otud4 C T 8: 79,664,108 T417I probably benign Het
Pagr1a T C 7: 127,015,442 E197G probably damaging Het
Pcdh18 T C 3: 49,744,977 Q1012R probably damaging Het
Pcdhgb5 A C 18: 37,731,637 I162L probably benign Het
Pdpr T A 8: 111,123,816 Y462N probably damaging Het
Pkhd1 A T 1: 20,523,142 H1582Q probably damaging Het
Polr1b A G 2: 129,110,108 K352R probably damaging Het
Poteg G A 8: 27,448,037 V12M probably damaging Het
Pou2f1 A C 1: 165,915,162 V54G probably damaging Het
Ppme1 A G 7: 100,344,975 L177P probably damaging Het
Prkce A G 17: 86,619,948 D550G probably damaging Het
Prrc2c A G 1: 162,680,758 probably null Het
Ptpn22 A G 3: 103,882,139 probably null Het
Rabif G A 1: 134,506,205 V86M probably damaging Het
Rbm25 T A 12: 83,668,507 M484K probably benign Het
Rcn2 G A 9: 56,057,429 A224T probably benign Het
Rexo5 T A 7: 119,834,403 probably null Het
Rnase1 A T 14: 51,145,762 I45N probably benign Het
Rnmt T A 18: 68,306,115 D98E possibly damaging Het
Rprd2 A G 3: 95,785,059 F188L probably damaging Het
Scube2 G A 7: 109,810,737 T643M probably damaging Het
Slc7a15 T C 12: 8,539,344 I68V probably benign Het
Slco1a5 A T 6: 142,242,125 V496D possibly damaging Het
Slitrk6 T G 14: 110,751,217 S353R possibly damaging Het
Smpd5 T A 15: 76,295,125 I53K possibly damaging Het
Tas2r108 T C 6: 40,494,087 S166P probably benign Het
Tecpr1 C A 5: 144,214,344 V245L possibly damaging Het
Tenm3 G T 8: 48,236,764 N1929K probably damaging Het
Tigd5 T G 15: 75,911,025 F412C probably damaging Het
Timm17a A T 1: 135,306,188 S74T possibly damaging Het
Tle1 A T 4: 72,139,808 L60Q probably damaging Het
Tmem132d T C 5: 127,796,000 E515G possibly damaging Het
Tmem65 T C 15: 58,794,397 N115S probably benign Het
Trmt5 C A 12: 73,281,652 R259L possibly damaging Het
Ttc37 T C 13: 76,185,200 W25R probably damaging Het
Vmn2r50 A T 7: 10,050,089 W153R probably benign Het
Vwa3a T G 7: 120,768,173 S184A probably benign Het
Zbtb25 A G 12: 76,349,164 L428P possibly damaging Het
Zbtb49 C T 5: 38,200,816 D698N probably damaging Het
Zbtb8os T G 4: 129,340,735 D35E probably damaging Het
Zfp316 T C 5: 143,264,491 T56A unknown Het
Zfp334 A T 2: 165,380,487 C545* probably null Het
Zmiz1 C A 14: 25,644,856 S247R probably damaging Het
Zscan18 A G 7: 12,775,381 probably benign Het
Other mutations in Zzef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Zzef1 APN 11 72875126 missense probably benign 0.02
IGL00898:Zzef1 APN 11 72875173 missense probably benign 0.00
IGL00970:Zzef1 APN 11 72915245 missense probably benign 0.06
IGL01062:Zzef1 APN 11 72874969 missense probably benign
IGL01832:Zzef1 APN 11 72875066 missense probably damaging 0.99
IGL02005:Zzef1 APN 11 72888299 missense probably benign 0.00
IGL02026:Zzef1 APN 11 72881338 missense probably benign 0.39
IGL02110:Zzef1 APN 11 72913112 missense probably damaging 1.00
IGL02305:Zzef1 APN 11 72866597 splice site probably benign
IGL02308:Zzef1 APN 11 72886747 missense probably benign 0.04
IGL02315:Zzef1 APN 11 72875257 nonsense probably null
IGL02332:Zzef1 APN 11 72916509 missense probably benign 0.01
IGL02389:Zzef1 APN 11 72891217 missense probably benign
IGL02389:Zzef1 APN 11 72899538 missense possibly damaging 0.89
IGL02451:Zzef1 APN 11 72901388 missense probably damaging 0.99
IGL02541:Zzef1 APN 11 72872649 missense probably damaging 1.00
IGL02950:Zzef1 APN 11 72917699 splice site probably benign
IGL02953:Zzef1 APN 11 72855398 missense probably benign
IGL03053:Zzef1 APN 11 72831539 splice site probably benign
IGL03085:Zzef1 APN 11 72855524 splice site probably benign
IGL03152:Zzef1 APN 11 72923182 critical splice donor site probably null
IGL03329:Zzef1 APN 11 72917273 splice site probably benign
IGL03376:Zzef1 APN 11 72876551 splice site probably benign
IGL03394:Zzef1 APN 11 72886775 splice site probably null
Dreidel UTSW 11 72908469 nonsense probably null
Hanukkah UTSW 11 72893332 missense probably benign 0.00
Mezuzah UTSW 11 72848733 nonsense probably null
BB005:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
BB015:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
PIT4508001:Zzef1 UTSW 11 72895176 missense probably benign
PIT4581001:Zzef1 UTSW 11 72899672 missense probably benign 0.00
PIT4810001:Zzef1 UTSW 11 72850745 missense probably damaging 1.00
R0094:Zzef1 UTSW 11 72817965 missense probably benign 0.01
R0119:Zzef1 UTSW 11 72821851 missense probably benign
R0136:Zzef1 UTSW 11 72821851 missense probably benign
R0140:Zzef1 UTSW 11 72899551 missense possibly damaging 0.70
R0212:Zzef1 UTSW 11 72873910 missense possibly damaging 0.66
R0217:Zzef1 UTSW 11 72889068 missense probably damaging 1.00
R0220:Zzef1 UTSW 11 72865966 missense probably damaging 1.00
R0304:Zzef1 UTSW 11 72880624 missense probably benign 0.10
R0400:Zzef1 UTSW 11 72895242 missense probably damaging 1.00
R0422:Zzef1 UTSW 11 72866091 missense possibly damaging 0.93
R0471:Zzef1 UTSW 11 72923111 missense probably damaging 1.00
R0557:Zzef1 UTSW 11 72917730 missense probably damaging 1.00
R0581:Zzef1 UTSW 11 72851900 missense probably benign 0.00
R0599:Zzef1 UTSW 11 72913178 missense probably damaging 1.00
R0603:Zzef1 UTSW 11 72818069 missense probably benign 0.00
R0657:Zzef1 UTSW 11 72821851 missense probably benign
R0987:Zzef1 UTSW 11 72901333 small deletion probably benign
R1246:Zzef1 UTSW 11 72874909 missense probably benign 0.00
R1327:Zzef1 UTSW 11 72893414 critical splice donor site probably null
R1438:Zzef1 UTSW 11 72912945 missense probably damaging 0.96
R1466:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1466:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1485:Zzef1 UTSW 11 72900809 splice site probably null
R1556:Zzef1 UTSW 11 72915233 missense probably damaging 1.00
R1563:Zzef1 UTSW 11 72848733 nonsense probably null
R1584:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1643:Zzef1 UTSW 11 72826202 missense probably damaging 1.00
R1646:Zzef1 UTSW 11 72864036 critical splice donor site probably null
R1764:Zzef1 UTSW 11 72893332 missense probably benign 0.00
R1777:Zzef1 UTSW 11 72910272 missense probably damaging 1.00
R1793:Zzef1 UTSW 11 72886709 missense probably damaging 1.00
R1900:Zzef1 UTSW 11 72848714 missense probably damaging 0.99
R2096:Zzef1 UTSW 11 72872639 missense probably benign 0.02
R2134:Zzef1 UTSW 11 72880624 missense probably benign 0.02
R2157:Zzef1 UTSW 11 72848634 splice site probably benign
R2183:Zzef1 UTSW 11 72886718 nonsense probably null
R2192:Zzef1 UTSW 11 72910156 splice site probably null
R2230:Zzef1 UTSW 11 72884416 missense probably damaging 0.99
R2259:Zzef1 UTSW 11 72900633 nonsense probably null
R2384:Zzef1 UTSW 11 72858394 missense probably damaging 0.99
R2426:Zzef1 UTSW 11 72915265 missense probably benign 0.01
R2915:Zzef1 UTSW 11 72910326 splice site probably null
R3700:Zzef1 UTSW 11 72886772 missense probably null 1.00
R3875:Zzef1 UTSW 11 72889040 missense probably benign 0.22
R3902:Zzef1 UTSW 11 72908500 missense probably damaging 1.00
R3927:Zzef1 UTSW 11 72858382 missense probably damaging 1.00
R4086:Zzef1 UTSW 11 72875053 missense probably benign 0.02
R4301:Zzef1 UTSW 11 72889035 missense probably damaging 0.96
R4359:Zzef1 UTSW 11 72823508 missense probably damaging 0.98
R4382:Zzef1 UTSW 11 72875112 missense probably benign 0.00
R4453:Zzef1 UTSW 11 72872639 missense probably benign 0.02
R4466:Zzef1 UTSW 11 72924659 missense probably damaging 1.00
R4471:Zzef1 UTSW 11 72913331 missense probably damaging 1.00
R4510:Zzef1 UTSW 11 72888170 missense probably benign 0.32
R4511:Zzef1 UTSW 11 72888170 missense probably benign 0.32
R4714:Zzef1 UTSW 11 72837212 missense probably damaging 1.00
R4799:Zzef1 UTSW 11 72859623 missense probably benign 0.12
R4906:Zzef1 UTSW 11 72901388 missense probably damaging 1.00
R5075:Zzef1 UTSW 11 72858344 missense probably damaging 1.00
R5357:Zzef1 UTSW 11 72843333 nonsense probably null
R5598:Zzef1 UTSW 11 72916521 missense probably damaging 1.00
R5725:Zzef1 UTSW 11 72855482 missense possibly damaging 0.86
R5765:Zzef1 UTSW 11 72821937 nonsense probably null
R5928:Zzef1 UTSW 11 72912852 missense probably damaging 1.00
R6003:Zzef1 UTSW 11 72824065 splice site probably null
R6047:Zzef1 UTSW 11 72866095 missense probably damaging 0.99
R6224:Zzef1 UTSW 11 72855383 missense probably damaging 0.99
R6225:Zzef1 UTSW 11 72869805 missense possibly damaging 0.62
R6287:Zzef1 UTSW 11 72923112 missense probably damaging 1.00
R6361:Zzef1 UTSW 11 72884349 missense possibly damaging 0.93
R6451:Zzef1 UTSW 11 72923156 missense possibly damaging 0.88
R6467:Zzef1 UTSW 11 72911264 critical splice donor site probably null
R6484:Zzef1 UTSW 11 72895271 missense probably damaging 1.00
R6493:Zzef1 UTSW 11 72913303 missense probably benign 0.06
R6520:Zzef1 UTSW 11 72826065 missense probably damaging 1.00
R6527:Zzef1 UTSW 11 72874990 missense probably benign 0.00
R6540:Zzef1 UTSW 11 72913229 missense probably damaging 1.00
R6608:Zzef1 UTSW 11 72912826 missense probably damaging 1.00
R6795:Zzef1 UTSW 11 72850659 missense probably benign 0.00
R6927:Zzef1 UTSW 11 72913157 missense probably damaging 1.00
R6987:Zzef1 UTSW 11 72855514 missense possibly damaging 0.89
R7048:Zzef1 UTSW 11 72866699 nonsense probably null
R7076:Zzef1 UTSW 11 72899559 missense probably benign 0.00
R7099:Zzef1 UTSW 11 72872649 missense possibly damaging 0.92
R7132:Zzef1 UTSW 11 72917871 critical splice donor site probably null
R7175:Zzef1 UTSW 11 72851901 missense possibly damaging 0.49
R7284:Zzef1 UTSW 11 72886690 missense probably damaging 0.99
R7300:Zzef1 UTSW 11 72875004 missense probably benign 0.02
R7486:Zzef1 UTSW 11 72864786 missense possibly damaging 0.85
R7503:Zzef1 UTSW 11 72826067 missense probably damaging 1.00
R7679:Zzef1 UTSW 11 72893278 missense probably benign
R7874:Zzef1 UTSW 11 72859653 missense probably benign 0.01
R7898:Zzef1 UTSW 11 72796547 missense probably damaging 1.00
R7928:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
R8021:Zzef1 UTSW 11 72823416 missense probably damaging 0.99
R8145:Zzef1 UTSW 11 72908469 nonsense probably null
R8255:Zzef1 UTSW 11 72875129 missense probably benign 0.00
R8303:Zzef1 UTSW 11 72917189 missense probably damaging 1.00
R8492:Zzef1 UTSW 11 72872604 missense probably damaging 1.00
R8492:Zzef1 UTSW 11 72886746 missense probably damaging 0.97
R8498:Zzef1 UTSW 11 72853322 missense probably damaging 1.00
R8547:Zzef1 UTSW 11 72844441 missense probably damaging 1.00
X0028:Zzef1 UTSW 11 72906979 missense probably benign 0.29
Z1176:Zzef1 UTSW 11 72796528 missense probably damaging 1.00
Z1177:Zzef1 UTSW 11 72796312 missense possibly damaging 0.91
Z1177:Zzef1 UTSW 11 72826178 missense probably damaging 1.00
Z1177:Zzef1 UTSW 11 72900631 critical splice acceptor site probably null
Z1177:Zzef1 UTSW 11 72915320 missense probably damaging 1.00
Z1186:Zzef1 UTSW 11 72889182 missense probably benign
Z1187:Zzef1 UTSW 11 72889182 missense probably benign
Z1188:Zzef1 UTSW 11 72889182 missense probably benign
Z1189:Zzef1 UTSW 11 72889182 missense probably benign
Z1190:Zzef1 UTSW 11 72889182 missense probably benign
Z1191:Zzef1 UTSW 11 72889182 missense probably benign
Z1192:Zzef1 UTSW 11 72889182 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACATGTGAGGATGACACTCTAGAG -3'
(R):5'- TTCAGATGCTGTACCTGGGG -3'

Sequencing Primer
(F):5'- ACACTTACCCATGGTGTGATGAC -3'
(R):5'- ATGCTGTACCTGGGGGAAGC -3'
Posted On2016-10-26