Incidental Mutation 'R0071:Ly75'
ID 43831
Institutional Source Beutler Lab
Gene Symbol Ly75
Ensembl Gene ENSMUSG00000026980
Gene Name lymphocyte antigen 75
Synonyms DEC-205, CD205
MMRRC Submission 038362-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0071 (G1)
Quality Score 139
Status Validated
Chromosome 2
Chromosomal Location 60122447-60213617 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 60152163 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 1130 (K1130R)
Ref Sequence ENSEMBL: ENSMUSP00000028362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028362] [ENSMUST00000112533]
AlphaFold Q60767
Predicted Effect probably benign
Transcript: ENSMUST00000028362
AA Change: K1130R

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000028362
Gene: ENSMUSG00000026980
AA Change: K1130R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112533
AA Change: K1130R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000108152
Gene: ENSMUSG00000026980
AA Change: K1130R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.2%
Validation Efficiency 99% (78/79)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display abnormalities in CD8-positive T cell morphology and cytotoxic T cell physiology. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A G 14: 35,812,746 (GRCm39) probably benign Het
Acot12 T C 13: 91,929,293 (GRCm39) probably benign Het
Acrbp T C 6: 125,027,915 (GRCm39) probably benign Het
Amotl1 G A 9: 14,460,069 (GRCm39) A890V probably benign Het
Aox3 T A 1: 58,211,050 (GRCm39) C931* probably null Het
Apob T A 12: 8,052,111 (GRCm39) V1184E probably damaging Het
Arhgap44 A T 11: 64,902,721 (GRCm39) L582Q possibly damaging Het
Bbx C T 16: 50,100,755 (GRCm39) E47K probably benign Het
Bccip A G 7: 133,315,960 (GRCm39) D72G probably damaging Het
Bckdha A T 7: 25,329,868 (GRCm39) probably null Het
Bmerb1 A G 16: 13,906,818 (GRCm39) D11G probably damaging Het
Cald1 C T 6: 34,735,069 (GRCm39) probably benign Het
Cby2 A G 14: 75,821,621 (GRCm39) S44P probably benign Het
Cdk11b T C 4: 155,733,880 (GRCm39) probably benign Het
Cebpe G T 14: 54,948,061 (GRCm39) R261S probably damaging Het
Cep95 C T 11: 106,681,554 (GRCm39) probably benign Het
Chi3l1 T C 1: 134,113,017 (GRCm39) Y150H probably benign Het
Chrnd T C 1: 87,120,559 (GRCm39) probably benign Het
Clec4g T A 8: 3,767,489 (GRCm39) probably benign Het
Cog2 T C 8: 125,275,407 (GRCm39) probably benign Het
Coro7 A T 16: 4,488,391 (GRCm39) L93Q probably damaging Het
Csmd3 T C 15: 47,460,217 (GRCm39) T3525A probably benign Het
Ctsc G A 7: 87,957,357 (GRCm39) probably benign Het
Dnajc16 T C 4: 141,495,318 (GRCm39) T467A probably benign Het
Dnmt1 G A 9: 20,819,916 (GRCm39) T1409I probably damaging Het
Fam227b T A 2: 125,965,994 (GRCm39) N144Y probably benign Het
Fam83h A G 15: 75,874,377 (GRCm39) S987P probably benign Het
Fhod1 A T 8: 106,063,857 (GRCm39) probably null Het
Folr1 A G 7: 101,513,130 (GRCm39) probably null Het
Glis3 C T 19: 28,241,255 (GRCm39) probably benign Het
Gm10069 T C 6: 128,449,688 (GRCm39) noncoding transcript Het
Golgb1 G A 16: 36,735,865 (GRCm39) R1704Q probably benign Het
Gpr158 C A 2: 21,815,479 (GRCm39) T624K probably benign Het
Helz2 T C 2: 180,878,200 (GRCm39) Y866C probably damaging Het
Itpkb T A 1: 180,160,330 (GRCm39) V152E probably damaging Het
Kcnma1 C T 14: 23,576,835 (GRCm39) R236H probably damaging Het
Klhl32 A G 4: 24,743,907 (GRCm39) V88A probably damaging Het
Lct C T 1: 128,219,755 (GRCm39) W1631* probably null Het
Lipa T A 19: 34,472,482 (GRCm39) K313M probably damaging Het
Mamdc2 C A 19: 23,280,994 (GRCm39) E685* probably null Het
Mdm1 A G 10: 117,982,701 (GRCm39) E112G probably damaging Het
Metrnl A T 11: 121,606,826 (GRCm39) M212L probably benign Het
Mettl2 A G 11: 105,022,468 (GRCm39) probably benign Het
Mxd3 A T 13: 55,477,449 (GRCm39) L11Q probably damaging Het
Myo7a A T 7: 97,706,037 (GRCm39) Y1836N probably damaging Het
Nsun7 A G 5: 66,421,388 (GRCm39) Y118C probably benign Het
Obscn G A 11: 58,955,027 (GRCm39) T3962M possibly damaging Het
Or13a20 A T 7: 140,232,170 (GRCm39) I93F probably benign Het
Or2d36 A G 7: 106,746,919 (GRCm39) Y132C probably damaging Het
Or5k3 C A 16: 58,969,578 (GRCm39) R122S probably benign Het
Osbpl11 T C 16: 33,034,708 (GRCm39) probably benign Het
Pcdhb22 A T 18: 37,653,131 (GRCm39) D276V probably damaging Het
Pik3cb A T 9: 98,926,918 (GRCm39) D886E probably benign Het
Pkhd1 T A 1: 20,271,568 (GRCm39) Y2995F probably benign Het
Raver2 C T 4: 100,977,642 (GRCm39) probably benign Het
Rhbdf1 A G 11: 32,160,498 (GRCm39) L684P probably damaging Het
Rufy2 C A 10: 62,824,946 (GRCm39) L75M possibly damaging Het
Sec22c A G 9: 121,521,979 (GRCm39) F44L probably damaging Het
Sephs1 A G 2: 4,904,371 (GRCm39) T250A probably benign Het
Serpina1a T C 12: 103,822,002 (GRCm39) K310R probably benign Het
Shoc1 A G 4: 59,059,643 (GRCm39) Y1006H possibly damaging Het
Sobp A G 10: 43,033,993 (GRCm39) L111P probably damaging Het
Sparcl1 G T 5: 104,233,707 (GRCm39) Y547* probably null Het
Spata31d1b G A 13: 59,863,163 (GRCm39) A104T probably benign Het
Spsb3 A G 17: 25,106,878 (GRCm39) D184G probably damaging Het
Sptan1 A T 2: 29,893,354 (GRCm39) K1148* probably null Het
Tdrd12 A G 7: 35,228,671 (GRCm39) V17A possibly damaging Het
Tlr9 A G 9: 106,100,777 (GRCm39) T23A probably benign Het
Tra2b A T 16: 22,073,151 (GRCm39) probably benign Het
Tspan15 A G 10: 62,038,849 (GRCm39) probably benign Het
Ttc41 A G 10: 86,572,710 (GRCm39) N694S probably benign Het
Ttn T G 2: 76,597,813 (GRCm39) D19700A probably damaging Het
Ube3b G A 5: 114,557,558 (GRCm39) G1014D probably damaging Het
Unc5d A G 8: 29,209,854 (GRCm39) V422A possibly damaging Het
Vmn2r80 C T 10: 79,007,566 (GRCm39) T514I possibly damaging Het
Zfp595 T C 13: 67,464,917 (GRCm39) K452E possibly damaging Het
Zfp607a A G 7: 27,577,694 (GRCm39) K255E probably damaging Het
Zxdc T G 6: 90,347,398 (GRCm39) V253G probably damaging Het
Other mutations in Ly75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Ly75 APN 2 60,206,421 (GRCm39) missense probably damaging 1.00
IGL01072:Ly75 APN 2 60,184,840 (GRCm39) missense probably damaging 1.00
IGL01409:Ly75 APN 2 60,152,036 (GRCm39) splice site probably null
IGL01432:Ly75 APN 2 60,206,351 (GRCm39) missense probably damaging 1.00
IGL01626:Ly75 APN 2 60,131,359 (GRCm39) missense probably benign 0.13
IGL01690:Ly75 APN 2 60,168,655 (GRCm39) missense probably damaging 1.00
IGL01862:Ly75 APN 2 60,129,516 (GRCm39) missense probably damaging 1.00
IGL01982:Ly75 APN 2 60,142,108 (GRCm39) missense probably damaging 1.00
IGL02075:Ly75 APN 2 60,182,700 (GRCm39) missense probably damaging 0.99
IGL02338:Ly75 APN 2 60,184,796 (GRCm39) missense probably benign 0.04
IGL02364:Ly75 APN 2 60,188,851 (GRCm39) missense probably damaging 1.00
IGL02456:Ly75 APN 2 60,124,125 (GRCm39) missense probably benign 0.09
IGL02474:Ly75 APN 2 60,213,526 (GRCm39) missense probably null 1.00
IGL02608:Ly75 APN 2 60,152,244 (GRCm39) missense probably benign 0.41
IGL02986:Ly75 APN 2 60,138,535 (GRCm39) missense probably damaging 1.00
IGL03015:Ly75 APN 2 60,206,504 (GRCm39) missense probably damaging 1.00
IGL03049:Ly75 APN 2 60,182,414 (GRCm39) missense probably damaging 0.99
euphues UTSW 2 60,129,389 (GRCm39) critical splice donor site probably null
four_score UTSW 2 60,142,115 (GRCm39) missense possibly damaging 0.75
lyly UTSW 2 60,158,217 (GRCm39) missense possibly damaging 0.49
Witty UTSW 2 60,184,844 (GRCm39) missense probably damaging 1.00
D605:Ly75 UTSW 2 60,182,696 (GRCm39) critical splice donor site probably null
R0046:Ly75 UTSW 2 60,169,801 (GRCm39) intron probably benign
R0055:Ly75 UTSW 2 60,152,262 (GRCm39) missense probably benign 0.01
R0055:Ly75 UTSW 2 60,152,262 (GRCm39) missense probably benign 0.01
R0071:Ly75 UTSW 2 60,152,163 (GRCm39) missense probably benign 0.01
R0285:Ly75 UTSW 2 60,148,663 (GRCm39) missense probably damaging 1.00
R0387:Ly75 UTSW 2 60,136,748 (GRCm39) missense probably benign 0.20
R0492:Ly75 UTSW 2 60,138,620 (GRCm39) missense probably damaging 1.00
R0688:Ly75 UTSW 2 60,146,565 (GRCm39) missense probably benign 0.41
R1367:Ly75 UTSW 2 60,124,102 (GRCm39) splice site probably null
R1463:Ly75 UTSW 2 60,199,101 (GRCm39) critical splice donor site probably null
R1581:Ly75 UTSW 2 60,158,237 (GRCm39) missense probably damaging 1.00
R1663:Ly75 UTSW 2 60,144,578 (GRCm39) missense probably damaging 1.00
R1818:Ly75 UTSW 2 60,142,121 (GRCm39) missense probably damaging 1.00
R1881:Ly75 UTSW 2 60,180,284 (GRCm39) missense probably benign 0.00
R2244:Ly75 UTSW 2 60,180,257 (GRCm39) missense probably benign 0.01
R2905:Ly75 UTSW 2 60,164,898 (GRCm39) missense probably benign 0.00
R3967:Ly75 UTSW 2 60,158,217 (GRCm39) missense possibly damaging 0.49
R3968:Ly75 UTSW 2 60,158,217 (GRCm39) missense possibly damaging 0.49
R4039:Ly75 UTSW 2 60,183,339 (GRCm39) missense probably damaging 1.00
R4406:Ly75 UTSW 2 60,184,894 (GRCm39) missense probably damaging 1.00
R4526:Ly75 UTSW 2 60,161,117 (GRCm39) missense probably benign 0.09
R4647:Ly75 UTSW 2 60,138,622 (GRCm39) missense probably damaging 1.00
R4795:Ly75 UTSW 2 60,180,284 (GRCm39) missense probably benign 0.00
R4796:Ly75 UTSW 2 60,180,284 (GRCm39) missense probably benign 0.00
R4962:Ly75 UTSW 2 60,182,469 (GRCm39) missense probably damaging 1.00
R4979:Ly75 UTSW 2 60,206,238 (GRCm39) missense probably damaging 1.00
R5072:Ly75 UTSW 2 60,206,307 (GRCm39) missense probably damaging 1.00
R5288:Ly75 UTSW 2 60,133,985 (GRCm39) missense probably damaging 1.00
R5373:Ly75 UTSW 2 60,142,115 (GRCm39) missense possibly damaging 0.75
R5374:Ly75 UTSW 2 60,142,115 (GRCm39) missense possibly damaging 0.75
R5384:Ly75 UTSW 2 60,164,831 (GRCm39) nonsense probably null
R5385:Ly75 UTSW 2 60,133,985 (GRCm39) missense probably damaging 1.00
R5395:Ly75 UTSW 2 60,195,455 (GRCm39) missense probably benign 0.41
R5531:Ly75 UTSW 2 60,195,489 (GRCm39) missense probably damaging 0.98
R5662:Ly75 UTSW 2 60,182,725 (GRCm39) missense probably damaging 1.00
R5667:Ly75 UTSW 2 60,138,655 (GRCm39) missense probably damaging 1.00
R5668:Ly75 UTSW 2 60,184,844 (GRCm39) missense probably damaging 1.00
R5671:Ly75 UTSW 2 60,138,655 (GRCm39) missense probably damaging 1.00
R5677:Ly75 UTSW 2 60,129,426 (GRCm39) missense probably benign 0.00
R5764:Ly75 UTSW 2 60,148,783 (GRCm39) missense probably benign
R5896:Ly75 UTSW 2 60,213,490 (GRCm39) missense probably benign
R6025:Ly75 UTSW 2 60,206,306 (GRCm39) missense probably damaging 1.00
R6113:Ly75 UTSW 2 60,199,217 (GRCm39) missense probably benign 0.04
R6448:Ly75 UTSW 2 60,129,389 (GRCm39) critical splice donor site probably null
R6601:Ly75 UTSW 2 60,148,720 (GRCm39) missense probably benign 0.11
R6745:Ly75 UTSW 2 60,138,523 (GRCm39) missense probably damaging 1.00
R6955:Ly75 UTSW 2 60,158,217 (GRCm39) missense possibly damaging 0.49
R6960:Ly75 UTSW 2 60,136,749 (GRCm39) missense probably benign
R7100:Ly75 UTSW 2 60,136,778 (GRCm39) missense probably benign
R7110:Ly75 UTSW 2 60,206,528 (GRCm39) missense probably benign 0.31
R7203:Ly75 UTSW 2 60,154,196 (GRCm39) nonsense probably null
R7291:Ly75 UTSW 2 60,160,337 (GRCm39) missense probably damaging 0.98
R7308:Ly75 UTSW 2 60,164,859 (GRCm39) missense probably benign 0.04
R7447:Ly75 UTSW 2 60,164,818 (GRCm39) nonsense probably null
R7512:Ly75 UTSW 2 60,164,907 (GRCm39) missense probably damaging 1.00
R7595:Ly75 UTSW 2 60,124,171 (GRCm39) missense probably benign 0.01
R7976:Ly75 UTSW 2 60,195,432 (GRCm39) missense probably damaging 1.00
R8005:Ly75 UTSW 2 60,163,278 (GRCm39) missense probably damaging 1.00
R8171:Ly75 UTSW 2 60,144,572 (GRCm39) missense possibly damaging 0.51
R8392:Ly75 UTSW 2 60,180,284 (GRCm39) missense probably benign 0.00
R8705:Ly75 UTSW 2 60,148,729 (GRCm39) missense probably damaging 0.98
R8714:Ly75 UTSW 2 60,164,829 (GRCm39) missense probably damaging 1.00
R8798:Ly75 UTSW 2 60,154,270 (GRCm39) missense probably benign 0.32
R8799:Ly75 UTSW 2 60,178,785 (GRCm39) missense probably damaging 1.00
R8834:Ly75 UTSW 2 60,161,433 (GRCm39) missense probably benign
R8990:Ly75 UTSW 2 60,188,903 (GRCm39) missense probably benign 0.10
R9015:Ly75 UTSW 2 60,146,442 (GRCm39) missense probably benign
R9547:Ly75 UTSW 2 60,161,069 (GRCm39) critical splice donor site probably null
R9628:Ly75 UTSW 2 60,158,285 (GRCm39) missense probably damaging 1.00
R9659:Ly75 UTSW 2 60,168,665 (GRCm39) missense probably damaging 1.00
R9660:Ly75 UTSW 2 60,154,184 (GRCm39) missense probably damaging 1.00
R9747:Ly75 UTSW 2 60,136,672 (GRCm39) critical splice donor site probably null
X0025:Ly75 UTSW 2 60,184,819 (GRCm39) missense probably damaging 1.00
Z1177:Ly75 UTSW 2 60,182,477 (GRCm39) missense possibly damaging 0.65
Z1177:Ly75 UTSW 2 60,180,348 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACCCGGCAACTTCTGATTCTAGC -3'
(R):5'- CTTTCTCCTCCCGGATGAAAGCAC -3'

Sequencing Primer
(F):5'- CTGATTCTAGCTCAGTCAACAGAG -3'
(R):5'- AACCAAGAGTGTCCTGGTTTC -3'
Posted On 2013-05-29