Incidental Mutation 'R0071:Klhl32'
ID43835
Institutional Source Beutler Lab
Gene Symbol Klhl32
Ensembl Gene ENSMUSG00000040387
Gene Namekelch-like 32
SynonymsLOC384000, D4Ertd389e, 6430524H05Rik
MMRRC Submission 038362-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R0071 (G1)
Quality Score154
Status Validated
Chromosome4
Chromosomal Location24612554-24851124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24743907 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 88 (V88A)
Ref Sequence ENSEMBL: ENSMUSP00000103849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084781] [ENSMUST00000108214] [ENSMUST00000108218] [ENSMUST00000140652] [ENSMUST00000150920]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084781
AA Change: V88A

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000081839
Gene: ENSMUSG00000040387
AA Change: V88A

DomainStartEndE-ValueType
BTB 42 138 1.28e-22 SMART
BACK 111 212 3.17e-22 SMART
Kelch 257 313 4.07e-1 SMART
Kelch 314 365 3.57e-1 SMART
Kelch 366 413 3.77e-4 SMART
Kelch 414 461 7.04e-4 SMART
Kelch 462 514 6.47e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108213
Predicted Effect probably damaging
Transcript: ENSMUST00000108214
AA Change: V88A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103849
Gene: ENSMUSG00000040387
AA Change: V88A

DomainStartEndE-ValueType
BTB 42 139 2.86e-25 SMART
BACK 144 225 3.31e-2 SMART
Blast:Kelch 233 285 1e-31 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000108218
AA Change: V88A

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103853
Gene: ENSMUSG00000040387
AA Change: V88A

DomainStartEndE-ValueType
BTB 42 139 2.86e-25 SMART
BACK 144 245 3.17e-22 SMART
Kelch 290 346 4.07e-1 SMART
Kelch 347 398 3.57e-1 SMART
Kelch 399 446 3.77e-4 SMART
Kelch 447 494 7.04e-4 SMART
Kelch 495 547 6.47e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000140652
AA Change: V88A

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000137312
Gene: ENSMUSG00000040387
AA Change: V88A

DomainStartEndE-ValueType
BTB 42 139 2.14e-24 SMART
Predicted Effect unknown
Transcript: ENSMUST00000150920
AA Change: V20A
SMART Domains Protein: ENSMUSP00000135917
Gene: ENSMUSG00000040387
AA Change: V20A

DomainStartEndE-ValueType
Blast:BTB 1 49 4e-19 BLAST
Meta Mutation Damage Score 0.5167 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.2%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik A G 16: 14,088,954 D11G probably damaging Het
4930474N05Rik A G 14: 36,090,789 probably benign Het
Acot12 T C 13: 91,781,174 probably benign Het
Acrbp T C 6: 125,050,952 probably benign Het
AI481877 A G 4: 59,059,643 Y1006H possibly damaging Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Aox3 T A 1: 58,171,891 C931* probably null Het
Apob T A 12: 8,002,111 V1184E probably damaging Het
Arhgap44 A T 11: 65,011,895 L582Q possibly damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Bccip A G 7: 133,714,231 D72G probably damaging Het
Bckdha A T 7: 25,630,443 probably null Het
Cald1 C T 6: 34,758,134 probably benign Het
Cdk11b T C 4: 155,649,423 probably benign Het
Cebpe G T 14: 54,710,604 R261S probably damaging Het
Cep95 C T 11: 106,790,728 probably benign Het
Chil1 T C 1: 134,185,279 Y150H probably benign Het
Chrnd T C 1: 87,192,837 probably benign Het
Clec4g T A 8: 3,717,489 probably benign Het
Cog2 T C 8: 124,548,668 probably benign Het
Coro7 A T 16: 4,670,527 L93Q probably damaging Het
Csmd3 T C 15: 47,596,821 T3525A probably benign Het
Ctsc G A 7: 88,308,149 probably benign Het
Dnajc16 T C 4: 141,768,007 T467A probably benign Het
Dnmt1 G A 9: 20,908,620 T1409I probably damaging Het
Fam227b T A 2: 126,124,074 N144Y probably benign Het
Fam83h A G 15: 76,002,528 S987P probably benign Het
Fhod1 A T 8: 105,337,225 probably null Het
Folr1 A G 7: 101,863,923 probably null Het
Glis3 C T 19: 28,263,855 probably benign Het
Gm10069 T C 6: 128,472,725 noncoding transcript Het
Golgb1 G A 16: 36,915,503 R1704Q probably benign Het
Gpr158 C A 2: 21,810,668 T624K probably benign Het
Helz2 T C 2: 181,236,407 Y866C probably damaging Het
Itpkb T A 1: 180,332,765 V152E probably damaging Het
Kcnma1 C T 14: 23,526,767 R236H probably damaging Het
Lct C T 1: 128,292,018 W1631* probably null Het
Lipa T A 19: 34,495,082 K313M probably damaging Het
Ly75 T C 2: 60,321,819 K1130R probably benign Het
Mamdc2 C A 19: 23,303,630 E685* probably null Het
Mdm1 A G 10: 118,146,796 E112G probably damaging Het
Metrnl A T 11: 121,716,000 M212L probably benign Het
Mettl2 A G 11: 105,131,642 probably benign Het
Mxd3 A T 13: 55,329,636 L11Q probably damaging Het
Myo7a A T 7: 98,056,830 Y1836N probably damaging Het
Nsun7 A G 5: 66,264,045 Y118C probably benign Het
Obscn G A 11: 59,064,201 T3962M possibly damaging Het
Olfr195 C A 16: 59,149,215 R122S probably benign Het
Olfr53 A T 7: 140,652,257 I93F probably benign Het
Olfr716 A G 7: 107,147,712 Y132C probably damaging Het
Osbpl11 T C 16: 33,214,338 probably benign Het
Pcdhb22 A T 18: 37,520,078 D276V probably damaging Het
Pik3cb A T 9: 99,044,865 D886E probably benign Het
Pkhd1 T A 1: 20,201,344 Y2995F probably benign Het
Raver2 C T 4: 101,120,445 probably benign Het
Rhbdf1 A G 11: 32,210,498 L684P probably damaging Het
Rufy2 C A 10: 62,989,167 L75M possibly damaging Het
Sec22c A G 9: 121,692,913 F44L probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpina1a T C 12: 103,855,743 K310R probably benign Het
Sobp A G 10: 43,157,997 L111P probably damaging Het
Sparcl1 G T 5: 104,085,841 Y547* probably null Het
Spata31d1b G A 13: 59,715,349 A104T probably benign Het
Spert A G 14: 75,584,181 S44P probably benign Het
Spsb3 A G 17: 24,887,904 D184G probably damaging Het
Sptan1 A T 2: 30,003,342 K1148* probably null Het
Tdrd12 A G 7: 35,529,246 V17A possibly damaging Het
Tlr9 A G 9: 106,223,578 T23A probably benign Het
Tra2b A T 16: 22,254,401 probably benign Het
Tspan15 A G 10: 62,203,070 probably benign Het
Ttc41 A G 10: 86,736,846 N694S probably benign Het
Ttn T G 2: 76,767,469 D19700A probably damaging Het
Ube3b G A 5: 114,419,497 G1014D probably damaging Het
Unc5d A G 8: 28,719,826 V422A possibly damaging Het
Vmn2r80 C T 10: 79,171,732 T514I possibly damaging Het
Zfp595 T C 13: 67,316,853 K452E possibly damaging Het
Zfp607a A G 7: 27,878,269 K255E probably damaging Het
Zxdc T G 6: 90,370,416 V253G probably damaging Het
Other mutations in Klhl32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Klhl32 APN 4 24682245 missense probably damaging 1.00
IGL02293:Klhl32 APN 4 24626935 missense probably damaging 1.00
IGL02374:Klhl32 APN 4 24743856 critical splice donor site probably null
IGL02824:Klhl32 APN 4 24682237 nonsense probably null
IGL03211:Klhl32 APN 4 24792616 critical splice donor site probably null
IGL03374:Klhl32 APN 4 24649533 intron probably benign
R0478:Klhl32 UTSW 4 24792777 missense probably damaging 1.00
R0856:Klhl32 UTSW 4 24682092 missense probably damaging 1.00
R0908:Klhl32 UTSW 4 24682092 missense probably damaging 1.00
R1882:Klhl32 UTSW 4 24743916 nonsense probably null
R1927:Klhl32 UTSW 4 24617474 missense probably benign 0.00
R2137:Klhl32 UTSW 4 24629275 nonsense probably null
R3176:Klhl32 UTSW 4 24682063 missense probably benign 0.39
R3276:Klhl32 UTSW 4 24682063 missense probably benign 0.39
R4059:Klhl32 UTSW 4 24792781 missense probably damaging 1.00
R4246:Klhl32 UTSW 4 24800822 missense possibly damaging 0.50
R4597:Klhl32 UTSW 4 24629339 missense probably benign 0.21
R4801:Klhl32 UTSW 4 24649698 missense possibly damaging 0.82
R4802:Klhl32 UTSW 4 24649698 missense possibly damaging 0.82
R4929:Klhl32 UTSW 4 24709030 missense probably damaging 1.00
R5654:Klhl32 UTSW 4 24800805 critical splice donor site probably null
R6039:Klhl32 UTSW 4 24792615 critical splice donor site probably null
R6039:Klhl32 UTSW 4 24792615 critical splice donor site probably null
R6362:Klhl32 UTSW 4 24629195 missense probably null 1.00
R6490:Klhl32 UTSW 4 24711578 intron probably benign
R6948:Klhl32 UTSW 4 24629250 missense probably benign 0.00
R6981:Klhl32 UTSW 4 24709030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCCATAACTGGGTCACTGAGC -3'
(R):5'- TCTAGCTATCAGATGGGTGCAGAGG -3'

Sequencing Primer
(F):5'- TCTTCACAACCACAGAGTTTGG -3'
(R):5'- TGCAGAGGCTTGTGAAAATG -3'
Posted On2013-05-29