Mutagenetix > Incidental Mutations

Incidental Mutation 'R5580:Strc'

438362

Institutional Source

Beutler Lab

Gene Symbol

Strc

Ensembl Gene

ENSMUSG00000033498

Gene Name

stereocilin

Synonyms

DFNB16

MMRRC Submission

043134-MU

Accession Numbers

Genbank: NM_080459; MGI: 2153816

Is this an essential gene?

Possibly non essential (E-score: 0.265) question?

Stock #

R5580 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121363728-121387168 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 121375012 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 879 (K879R)

Ref Sequence

ENSEMBL: ENSMUSP00000039378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038389] [ENSMUST00000129136]

Predicted Effect

probably damaging
Transcript: ENSMUST00000038389
AA Change: K879R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: K879R

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	74	87	N/A	INTRINSIC
low complexity region	108	119	N/A	INTRINSIC
low complexity region	132	161	N/A	INTRINSIC
low complexity region	277	291	N/A	INTRINSIC
low complexity region	376	425	N/A	INTRINSIC
low complexity region	610	635	N/A	INTRINSIC
low complexity region	656	677	N/A	INTRINSIC
low complexity region	728	746	N/A	INTRINSIC
low complexity region	898	921	N/A	INTRINSIC
low complexity region	1168	1194	N/A	INTRINSIC
low complexity region	1287	1302	N/A	INTRINSIC
low complexity region	1560	1580	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000129136
AA Change: K7R

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498
AA Change: K7R

Domain	Start	End	E-Value	Type
low complexity region	26	49	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134443

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149219

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150332

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	T	13: 59,742,256	D583E	probably benign	Het
2410002F23Rik	A	G	7: 44,251,240	T73A	possibly damaging	Het
A1bg	A	T	15: 60,919,032	V365E	probably benign	Het
Abcg5	A	C	17: 84,660,154	V406G	probably damaging	Het
Adamts12	A	G	15: 11,152,000	Y192C	probably benign	Het
Add3	C	T	19: 53,245,211	S649L	probably damaging	Het
Adgrg6	A	T	10: 14,410,484	C1129*	probably null	Het
Arsb	T	A	13: 93,807,545	V248D	probably damaging	Het
AW554918	A	T	18: 25,339,865	N39I	probably damaging	Het
Cacna1b	A	T	2: 24,650,554	I1383N	probably damaging	Het
Caprin2	A	T	6: 148,858,734	V625D	possibly damaging	Het
Cd9	A	G	6: 125,464,457	L67P	probably damaging	Het
Cdh5	T	A	8: 104,125,494	Y80*	probably null	Het
Csf2ra	A	G	19: 61,226,217	L223P	probably damaging	Het
Cyp2c67	T	C	19: 39,615,650	K421E	probably damaging	Het
Dzank1	T	C	2: 144,506,178	R223G	probably damaging	Het
Emilin2	A	G	17: 71,275,230	V167A	probably benign	Het
Eps8l3	A	G	3: 107,881,603	T81A	probably damaging	Het
Esrra	T	C	19: 6,920,387	M1V	probably null	Het
Evpl	C	A	11: 116,234,232	A135S	probably benign	Het
Fam193a	A	G	5: 34,420,788	I209V	probably benign	Het
Fbxl19	C	A	7: 127,750,996	C253*	probably null	Het
Fer1l5	T	A	1: 36,385,458	Y305*	probably null	Het
Fzd2	A	C	11: 102,605,839	I370L	probably damaging	Het
Gm8882	T	C	6: 132,361,469	N262S	unknown	Het
Gnl3	T	C	14: 31,015,285	K212R	probably benign	Het
Golm1	A	G	13: 59,642,365	L207P	probably benign	Het
Gphn	T	A	12: 78,492,044	F155I	probably damaging	Het
Grhl1	G	A	12: 24,609,740	G500S	probably benign	Het
Gucd1	C	A	10: 75,511,134	G55V	possibly damaging	Het
Haus6	A	T	4: 86,599,266	I287K	possibly damaging	Het
Hmcn1	G	A	1: 150,577,539	P5342S	probably benign	Het
Hspa12a	A	G	19: 58,799,660	S577P	probably benign	Het
Ido2	T	A	8: 24,550,866	I113F	possibly damaging	Het
Ifrd2	C	T	9: 107,592,312	P396S	probably damaging	Het
Igkv4-86	T	A	6: 68,911,006		probably benign	Het
Ipo11	A	G	13: 106,900,747	V196A	probably benign	Het
Itih2	T	C	2: 10,123,476	E138G	probably damaging	Het
Kidins220	T	G	12: 25,047,897	C1179G	probably benign	Het
Kif20b	T	A	19: 34,949,728		probably null	Het
Klk1	T	A	7: 44,228,814	Y63N	probably benign	Het
L3mbtl3	T	G	10: 26,303,706	D517A	unknown	Het
Lars	G	T	18: 42,214,851	P969H	probably damaging	Het
Lrp1	C	T	10: 127,588,520	V766I	probably benign	Het
Lrrc8c	A	G	5: 105,607,687	I443V	probably benign	Het
Lsg1	T	C	16: 30,569,167	M439V	probably null	Het
Magi2	T	A	5: 20,215,424	M286K	probably benign	Het
Med11	T	C	11: 70,452,065		probably null	Het
Med13l	A	G	5: 118,751,630	K1819E	possibly damaging	Het
Ms4a14	T	A	19: 11,303,226	Q656L	probably benign	Het
Muc5b	A	G	7: 141,861,347	T2677A	possibly damaging	Het
Myo7a	A	T	7: 98,073,160	L1186H	probably damaging	Het
Naca	C	A	10: 128,040,593		probably benign	Het
Nbeal1	T	C	1: 60,242,602	I828T	probably benign	Het
Ncor1	A	T	11: 62,389,778	C75*	probably null	Het
Nepn	A	C	10: 52,404,302	S497R	probably damaging	Het
Nf2	A	G	11: 4,803,689	F222L	probably damaging	Het
Nlrp9b	A	C	7: 20,023,164	T109P	probably damaging	Het
Nr1h4	A	T	10: 89,516,440	F22I	probably benign	Het
Ogg1	A	G	6: 113,329,376	Y178C	probably damaging	Het
Olfr1162	A	T	2: 88,050,324	M100K	possibly damaging	Het
Olfr1271	C	A	2: 90,266,350	V27L	probably benign	Het
Olfr1444	G	A	19: 12,861,804	V10M	possibly damaging	Het
Olfr1475	T	A	19: 13,479,427	Y257F	probably damaging	Het
Olfr381	G	T	11: 73,486,210	P205T	probably benign	Het
Osr1	G	A	12: 9,579,325	R66Q	probably damaging	Het
Pi4ka	A	G	16: 17,281,087	S1978P	probably damaging	Het
Pik3c2g	A	T	6: 139,626,533	Q239L	probably damaging	Het
Pin1rt1	A	G	2: 104,714,325	I154T	probably damaging	Het
Pkdcc	A	G	17: 83,220,082	T230A	probably damaging	Het
Por	A	T	5: 135,733,821	I430F	probably damaging	Het
Prkcsh	T	A	9: 22,011,255		probably null	Het
Pros1	A	G	16: 62,926,326		probably null	Het
Pus10	T	A	11: 23,672,556	L59I	probably benign	Het
Pxmp2	A	G	5: 110,283,676	V67A	possibly damaging	Het
Rab3gap1	C	A	1: 127,930,990	A612E	probably benign	Het
Rpap2	A	G	5: 107,620,145	E206G	probably benign	Het
Rpl31	C	T	1: 39,370,027	R41C	probably benign	Het
Ryr3	C	T	2: 112,841,948	G1393R	probably damaging	Het
Scara5	T	C	14: 65,731,079	M267T	probably benign	Het
Sema5a	A	T	15: 32,574,885	I380F	probably benign	Het
Slc36a3	A	G	11: 55,135,453	S180P	probably benign	Het
Slc44a5	A	G	3: 154,261,285	K536R	probably benign	Het
Smg1	T	C	7: 118,148,902		probably benign	Het
Swt1	T	C	1: 151,384,455	E731G	probably benign	Het
Syngap1	G	A	17: 26,962,331	A9T	probably damaging	Het
Tex15	C	T	8: 33,572,429	T903I	probably damaging	Het
Tg	A	G	15: 66,685,300	I937V	possibly damaging	Het
Tm9sf4	T	C	2: 153,182,430	Y58H	probably damaging	Het
Tsen2	A	T	6: 115,577,980	D458V	probably damaging	Het
Ttn	T	A	2: 76,917,802	D4301V	probably benign	Het
Txk	C	A	5: 72,707,589	L314F	probably damaging	Het
Ube3b	A	G	5: 114,415,323	T919A	probably benign	Het
Ubn2	A	G	6: 38,483,252	M641V	probably damaging	Het
Usp4	C	T	9: 108,365,859	T242I	probably benign	Het
Usp53	A	G	3: 122,934,234	S900P	probably benign	Het
Vmn1r225	T	C	17: 20,502,839	Y181H	probably damaging	Het
Vmn1r83	T	A	7: 12,321,873	I86L	probably benign	Het
Vmn2r65	T	C	7: 84,947,594	I84M	probably damaging	Het
Vstm2b	A	G	7: 40,902,626	H126R	probably damaging	Het
Zfp524	A	T	7: 5,018,417	I315F	probably benign	Het
Zfp975	A	T	7: 42,665,089	L20*	probably null	Het

Other mutations in Strc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Strc	APN	2	121365060	missense	probably benign	0.39
IGL01152:Strc	APN	2	121370795	missense	probably benign
IGL01608:Strc	APN	2	121375594	missense	probably benign	0.05
IGL01695:Strc	APN	2	121375298	missense	probably damaging	1.00
IGL01715:Strc	APN	2	121365737	splice site	probably null
IGL01906:Strc	APN	2	121377634	missense	probably benign
IGL02135:Strc	APN	2	121364834	missense	probably damaging	1.00
IGL02416:Strc	APN	2	121369058	missense	probably damaging	1.00
IGL02455:Strc	APN	2	121375791	unclassified	probably benign
IGL03029:Strc	APN	2	121364044	missense	possibly damaging	0.95
IGL03176:Strc	APN	2	121372180	missense	probably damaging	0.99
IGL03272:Strc	APN	2	121371751	missense	probably damaging	1.00
3-1:Strc	UTSW	2	121373680	missense	probably damaging	0.99
IGL02799:Strc	UTSW	2	121379236	missense	probably damaging	1.00
PIT4283001:Strc	UTSW	2	121375307	missense	probably damaging	1.00
R0022:Strc	UTSW	2	121368393	missense	probably damaging	1.00
R0494:Strc	UTSW	2	121379533	missense	probably damaging	0.99
R1065:Strc	UTSW	2	121366651	missense	probably damaging	1.00
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1203:Strc	UTSW	2	121372123	missense	possibly damaging	0.66
R1343:Strc	UTSW	2	121365115	missense	probably benign	0.21
R1544:Strc	UTSW	2	121372738	splice site	probably null
R1650:Strc	UTSW	2	121380885	start gained	probably benign
R1840:Strc	UTSW	2	121379296	missense	probably damaging	1.00
R1983:Strc	UTSW	2	121371037	missense	possibly damaging	0.54
R2035:Strc	UTSW	2	121374934	missense	probably damaging	1.00
R2058:Strc	UTSW	2	121378887	missense	probably damaging	1.00
R2158:Strc	UTSW	2	121365862	missense	probably benign	0.10
R2219:Strc	UTSW	2	121364523	missense	probably damaging	1.00
R2680:Strc	UTSW	2	121365111	missense	probably damaging	0.99
R4375:Strc	UTSW	2	121380823	missense	unknown
R4563:Strc	UTSW	2	121365805	missense	probably benign	0.02
R4578:Strc	UTSW	2	121378003	missense	possibly damaging	0.94
R4607:Strc	UTSW	2	121372945	missense	probably benign	0.31
R4651:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4652:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4790:Strc	UTSW	2	121375594	missense	probably benign	0.05
R5480:Strc	UTSW	2	121364819	missense	probably benign	0.00
R5679:Strc	UTSW	2	121368100	missense	probably benign	0.03
R5703:Strc	UTSW	2	121370814	missense	probably benign
R5841:Strc	UTSW	2	121365877	missense	probably benign	0.29
R5917:Strc	UTSW	2	121379309	missense	probably benign
R5958:Strc	UTSW	2	121376922	missense	possibly damaging	0.56
R6320:Strc	UTSW	2	121374958	missense	probably benign	0.16
R6619:Strc	UTSW	2	121368432	missense	probably damaging	0.99
R6695:Strc	UTSW	2	121377224	missense	probably benign	0.35
R6970:Strc	UTSW	2	121378014	missense	probably benign	0.41
R7018:Strc	UTSW	2	121369058	missense	probably damaging	1.00
R7045:Strc	UTSW	2	121370726	missense	probably damaging	1.00
R7190:Strc	UTSW	2	121369026	missense	probably benign	0.14
R7283:Strc	UTSW	2	121379452	missense	probably damaging	0.99
R7694:Strc	UTSW	2	121377096	missense	probably damaging	1.00
R7699:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7700:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7756:Strc	UTSW	2	121370946	missense	probably benign
R7758:Strc	UTSW	2	121370946	missense	probably benign
R7822:Strc	UTSW	2	121377738	missense	probably benign	0.01
R7830:Strc	UTSW	2	121375049	missense	probably damaging	0.99
R7953:Strc	UTSW	2	121377363	missense	probably damaging	0.99
R8137:Strc	UTSW	2	121366738	missense	probably damaging	0.98
R8394:Strc	UTSW	2	121379009	missense	probably benign	0.00
R8427:Strc	UTSW	2	121377531	missense	probably damaging	1.00
Z1176:Strc	UTSW	2	121375521	missense	probably damaging	0.98
Z1176:Strc	UTSW	2	121379044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCTGCTACTGGCCAGCTATCC -3'
(R):5'- ACTATTCCTGCCCGTCAAGC -3'

Sequencing Primer
(F):5'- CAGGGCCTGGATCTGAGATG -3'
(R):5'- CCCACCGGCCTACAGAGAG -3'

Posted On

2016-10-26