Incidental Mutation 'R0071:Sparcl1'
ID43841
Institutional Source Beutler Lab
Gene Symbol Sparcl1
Ensembl Gene ENSMUSG00000029309
Gene NameSPARC-like 1
SynonymsEcm2, mast9, Sc1, hevin
MMRRC Submission 038362-MU
Accession Numbers

Ncbi RefSeq: NM_010097.4; MGI:108110

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0071 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location104079111-104113733 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 104085841 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 547 (Y547*)
Ref Sequence ENSEMBL: ENSMUSP00000031249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031249]
Predicted Effect probably null
Transcript: ENSMUST00000031249
AA Change: Y547*
SMART Domains Protein: ENSMUSP00000031249
Gene: ENSMUSG00000029309
AA Change: Y547*

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 90 101 N/A INTRINSIC
low complexity region 192 210 N/A INTRINSIC
low complexity region 330 340 N/A INTRINSIC
low complexity region 372 381 N/A INTRINSIC
FOLN 418 441 2.33e-5 SMART
KAZAL 441 495 3.62e-11 SMART
Pfam:SPARC_Ca_bdg 498 636 2.8e-44 PFAM
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.2%
Validation Efficiency 99% (78/79)
MGI Phenotype Strain: 2153047
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal histology and survival. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(1) Gene trapped(4)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik A G 16: 14,088,954 D11G probably damaging Het
4930474N05Rik A G 14: 36,090,789 probably benign Het
Acot12 T C 13: 91,781,174 probably benign Het
Acrbp T C 6: 125,050,952 probably benign Het
AI481877 A G 4: 59,059,643 Y1006H possibly damaging Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Aox3 T A 1: 58,171,891 C931* probably null Het
Apob T A 12: 8,002,111 V1184E probably damaging Het
Arhgap44 A T 11: 65,011,895 L582Q possibly damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Bccip A G 7: 133,714,231 D72G probably damaging Het
Bckdha A T 7: 25,630,443 probably null Het
Cald1 C T 6: 34,758,134 probably benign Het
Cdk11b T C 4: 155,649,423 probably benign Het
Cebpe G T 14: 54,710,604 R261S probably damaging Het
Cep95 C T 11: 106,790,728 probably benign Het
Chil1 T C 1: 134,185,279 Y150H probably benign Het
Chrnd T C 1: 87,192,837 probably benign Het
Clec4g T A 8: 3,717,489 probably benign Het
Cog2 T C 8: 124,548,668 probably benign Het
Coro7 A T 16: 4,670,527 L93Q probably damaging Het
Csmd3 T C 15: 47,596,821 T3525A probably benign Het
Ctsc G A 7: 88,308,149 probably benign Het
Dnajc16 T C 4: 141,768,007 T467A probably benign Het
Dnmt1 G A 9: 20,908,620 T1409I probably damaging Het
Fam227b T A 2: 126,124,074 N144Y probably benign Het
Fam83h A G 15: 76,002,528 S987P probably benign Het
Fhod1 A T 8: 105,337,225 probably null Het
Folr1 A G 7: 101,863,923 probably null Het
Glis3 C T 19: 28,263,855 probably benign Het
Gm10069 T C 6: 128,472,725 noncoding transcript Het
Golgb1 G A 16: 36,915,503 R1704Q probably benign Het
Gpr158 C A 2: 21,810,668 T624K probably benign Het
Helz2 T C 2: 181,236,407 Y866C probably damaging Het
Itpkb T A 1: 180,332,765 V152E probably damaging Het
Kcnma1 C T 14: 23,526,767 R236H probably damaging Het
Klhl32 A G 4: 24,743,907 V88A probably damaging Het
Lct C T 1: 128,292,018 W1631* probably null Het
Lipa T A 19: 34,495,082 K313M probably damaging Het
Ly75 T C 2: 60,321,819 K1130R probably benign Het
Mamdc2 C A 19: 23,303,630 E685* probably null Het
Mdm1 A G 10: 118,146,796 E112G probably damaging Het
Metrnl A T 11: 121,716,000 M212L probably benign Het
Mettl2 A G 11: 105,131,642 probably benign Het
Mxd3 A T 13: 55,329,636 L11Q probably damaging Het
Myo7a A T 7: 98,056,830 Y1836N probably damaging Het
Nsun7 A G 5: 66,264,045 Y118C probably benign Het
Obscn G A 11: 59,064,201 T3962M possibly damaging Het
Olfr195 C A 16: 59,149,215 R122S probably benign Het
Olfr53 A T 7: 140,652,257 I93F probably benign Het
Olfr716 A G 7: 107,147,712 Y132C probably damaging Het
Osbpl11 T C 16: 33,214,338 probably benign Het
Pcdhb22 A T 18: 37,520,078 D276V probably damaging Het
Pik3cb A T 9: 99,044,865 D886E probably benign Het
Pkhd1 T A 1: 20,201,344 Y2995F probably benign Het
Raver2 C T 4: 101,120,445 probably benign Het
Rhbdf1 A G 11: 32,210,498 L684P probably damaging Het
Rufy2 C A 10: 62,989,167 L75M possibly damaging Het
Sec22c A G 9: 121,692,913 F44L probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpina1a T C 12: 103,855,743 K310R probably benign Het
Sobp A G 10: 43,157,997 L111P probably damaging Het
Spata31d1b G A 13: 59,715,349 A104T probably benign Het
Spert A G 14: 75,584,181 S44P probably benign Het
Spsb3 A G 17: 24,887,904 D184G probably damaging Het
Sptan1 A T 2: 30,003,342 K1148* probably null Het
Tdrd12 A G 7: 35,529,246 V17A possibly damaging Het
Tlr9 A G 9: 106,223,578 T23A probably benign Het
Tra2b A T 16: 22,254,401 probably benign Het
Tspan15 A G 10: 62,203,070 probably benign Het
Ttc41 A G 10: 86,736,846 N694S probably benign Het
Ttn T G 2: 76,767,469 D19700A probably damaging Het
Ube3b G A 5: 114,419,497 G1014D probably damaging Het
Unc5d A G 8: 28,719,826 V422A possibly damaging Het
Vmn2r80 C T 10: 79,171,732 T514I possibly damaging Het
Zfp595 T C 13: 67,316,853 K452E possibly damaging Het
Zfp607a A G 7: 27,878,269 K255E probably damaging Het
Zxdc T G 6: 90,370,416 V253G probably damaging Het
Other mutations in Sparcl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00653:Sparcl1 APN 5 104092922 missense probably benign 0.04
IGL01291:Sparcl1 APN 5 104094715 missense possibly damaging 0.88
IGL01958:Sparcl1 APN 5 104092540 missense probably benign 0.30
IGL02749:Sparcl1 APN 5 104092880 missense possibly damaging 0.57
IGL03034:Sparcl1 APN 5 104093237 missense probably damaging 0.96
ANU05:Sparcl1 UTSW 5 104094715 missense possibly damaging 0.88
R0007:Sparcl1 UTSW 5 104087080 missense probably damaging 1.00
R0007:Sparcl1 UTSW 5 104087080 missense probably damaging 1.00
R0071:Sparcl1 UTSW 5 104085841 nonsense probably null
R0278:Sparcl1 UTSW 5 104088397 missense probably benign 0.16
R0360:Sparcl1 UTSW 5 104089637 missense probably damaging 0.99
R0581:Sparcl1 UTSW 5 104093312 missense probably damaging 0.99
R1755:Sparcl1 UTSW 5 104092824 missense probably benign 0.12
R1807:Sparcl1 UTSW 5 104085761 missense probably damaging 1.00
R1925:Sparcl1 UTSW 5 104093354 missense probably benign 0.09
R2110:Sparcl1 UTSW 5 104088423 missense probably damaging 1.00
R2112:Sparcl1 UTSW 5 104088423 missense probably damaging 1.00
R2331:Sparcl1 UTSW 5 104085794 missense probably damaging 1.00
R2567:Sparcl1 UTSW 5 104085088 missense probably damaging 1.00
R3029:Sparcl1 UTSW 5 104093226 missense possibly damaging 0.59
R3104:Sparcl1 UTSW 5 104093337 missense probably benign 0.00
R3106:Sparcl1 UTSW 5 104093337 missense probably benign 0.00
R3979:Sparcl1 UTSW 5 104092781 missense probably benign 0.00
R4772:Sparcl1 UTSW 5 104088490 missense probably benign 0.15
R4967:Sparcl1 UTSW 5 104092910 missense probably damaging 1.00
R5095:Sparcl1 UTSW 5 104085763 missense probably damaging 1.00
R5103:Sparcl1 UTSW 5 104085763 missense probably damaging 1.00
R5105:Sparcl1 UTSW 5 104085763 missense probably damaging 1.00
R5140:Sparcl1 UTSW 5 104085763 missense probably damaging 1.00
R5149:Sparcl1 UTSW 5 104085763 missense probably damaging 1.00
R6245:Sparcl1 UTSW 5 104085147 missense probably damaging 1.00
R6387:Sparcl1 UTSW 5 104085060 missense probably damaging 1.00
R6544:Sparcl1 UTSW 5 104092444 nonsense probably null
R6930:Sparcl1 UTSW 5 104087074 missense probably damaging 1.00
R7246:Sparcl1 UTSW 5 104085157 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTCCCAACTGGGTCTCAATTCCG -3'
(R):5'- AACATTTCTGCCCTCATAGACCAGC -3'

Sequencing Primer
(F):5'- GGTCTCAATTCCGTTTCACAGAG -3'
(R):5'- gaagatacagcaacagacacac -3'
Posted On2013-05-29