Incidental Mutation 'R0071:Ube3b'
ID43842
Institutional Source Beutler Lab
Gene Symbol Ube3b
Ensembl Gene ENSMUSG00000029577
Gene Nameubiquitin protein ligase E3B
Synonyms
MMRRC Submission 038362-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0071 (G1)
Quality Score93
Status Validated
Chromosome5
Chromosomal Location114380607-114421169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 114419497 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 1014 (G1014D)
Ref Sequence ENSEMBL: ENSMUSP00000073652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]
Predicted Effect probably damaging
Transcript: ENSMUST00000074002
AA Change: G1014D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: G1014D

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
low complexity region 470 488 N/A INTRINSIC
HECTc 697 1070 2.15e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130169
SMART Domains Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196651
SMART Domains Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
HECTc 122 495 1.1e-112 SMART
Meta Mutation Damage Score 0.604 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.2%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik A G 16: 14,088,954 D11G probably damaging Het
4930474N05Rik A G 14: 36,090,789 probably benign Het
Acot12 T C 13: 91,781,174 probably benign Het
Acrbp T C 6: 125,050,952 probably benign Het
AI481877 A G 4: 59,059,643 Y1006H possibly damaging Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Aox3 T A 1: 58,171,891 C931* probably null Het
Apob T A 12: 8,002,111 V1184E probably damaging Het
Arhgap44 A T 11: 65,011,895 L582Q possibly damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Bccip A G 7: 133,714,231 D72G probably damaging Het
Bckdha A T 7: 25,630,443 probably null Het
Cald1 C T 6: 34,758,134 probably benign Het
Cdk11b T C 4: 155,649,423 probably benign Het
Cebpe G T 14: 54,710,604 R261S probably damaging Het
Cep95 C T 11: 106,790,728 probably benign Het
Chil1 T C 1: 134,185,279 Y150H probably benign Het
Chrnd T C 1: 87,192,837 probably benign Het
Clec4g T A 8: 3,717,489 probably benign Het
Cog2 T C 8: 124,548,668 probably benign Het
Coro7 A T 16: 4,670,527 L93Q probably damaging Het
Csmd3 T C 15: 47,596,821 T3525A probably benign Het
Ctsc G A 7: 88,308,149 probably benign Het
Dnajc16 T C 4: 141,768,007 T467A probably benign Het
Dnmt1 G A 9: 20,908,620 T1409I probably damaging Het
Fam227b T A 2: 126,124,074 N144Y probably benign Het
Fam83h A G 15: 76,002,528 S987P probably benign Het
Fhod1 A T 8: 105,337,225 probably null Het
Folr1 A G 7: 101,863,923 probably null Het
Glis3 C T 19: 28,263,855 probably benign Het
Gm10069 T C 6: 128,472,725 noncoding transcript Het
Golgb1 G A 16: 36,915,503 R1704Q probably benign Het
Gpr158 C A 2: 21,810,668 T624K probably benign Het
Helz2 T C 2: 181,236,407 Y866C probably damaging Het
Itpkb T A 1: 180,332,765 V152E probably damaging Het
Kcnma1 C T 14: 23,526,767 R236H probably damaging Het
Klhl32 A G 4: 24,743,907 V88A probably damaging Het
Lct C T 1: 128,292,018 W1631* probably null Het
Lipa T A 19: 34,495,082 K313M probably damaging Het
Ly75 T C 2: 60,321,819 K1130R probably benign Het
Mamdc2 C A 19: 23,303,630 E685* probably null Het
Mdm1 A G 10: 118,146,796 E112G probably damaging Het
Metrnl A T 11: 121,716,000 M212L probably benign Het
Mettl2 A G 11: 105,131,642 probably benign Het
Mxd3 A T 13: 55,329,636 L11Q probably damaging Het
Myo7a A T 7: 98,056,830 Y1836N probably damaging Het
Nsun7 A G 5: 66,264,045 Y118C probably benign Het
Obscn G A 11: 59,064,201 T3962M possibly damaging Het
Olfr195 C A 16: 59,149,215 R122S probably benign Het
Olfr53 A T 7: 140,652,257 I93F probably benign Het
Olfr716 A G 7: 107,147,712 Y132C probably damaging Het
Osbpl11 T C 16: 33,214,338 probably benign Het
Pcdhb22 A T 18: 37,520,078 D276V probably damaging Het
Pik3cb A T 9: 99,044,865 D886E probably benign Het
Pkhd1 T A 1: 20,201,344 Y2995F probably benign Het
Raver2 C T 4: 101,120,445 probably benign Het
Rhbdf1 A G 11: 32,210,498 L684P probably damaging Het
Rufy2 C A 10: 62,989,167 L75M possibly damaging Het
Sec22c A G 9: 121,692,913 F44L probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpina1a T C 12: 103,855,743 K310R probably benign Het
Sobp A G 10: 43,157,997 L111P probably damaging Het
Sparcl1 G T 5: 104,085,841 Y547* probably null Het
Spata31d1b G A 13: 59,715,349 A104T probably benign Het
Spert A G 14: 75,584,181 S44P probably benign Het
Spsb3 A G 17: 24,887,904 D184G probably damaging Het
Sptan1 A T 2: 30,003,342 K1148* probably null Het
Tdrd12 A G 7: 35,529,246 V17A possibly damaging Het
Tlr9 A G 9: 106,223,578 T23A probably benign Het
Tra2b A T 16: 22,254,401 probably benign Het
Tspan15 A G 10: 62,203,070 probably benign Het
Ttc41 A G 10: 86,736,846 N694S probably benign Het
Ttn T G 2: 76,767,469 D19700A probably damaging Het
Unc5d A G 8: 28,719,826 V422A possibly damaging Het
Vmn2r80 C T 10: 79,171,732 T514I possibly damaging Het
Zfp595 T C 13: 67,316,853 K452E possibly damaging Het
Zfp607a A G 7: 27,878,269 K255E probably damaging Het
Zxdc T G 6: 90,370,416 V253G probably damaging Het
Other mutations in Ube3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ube3b APN 5 114415287 missense possibly damaging 0.93
IGL01154:Ube3b APN 5 114406252 missense probably null 0.86
IGL02632:Ube3b APN 5 114398841 missense probably benign
IGL02850:Ube3b APN 5 114406249 missense probably damaging 1.00
IGL02878:Ube3b APN 5 114404717 splice site probably null
IGL02881:Ube3b APN 5 114412884 missense possibly damaging 0.78
R0003:Ube3b UTSW 5 114398851 missense probably benign 0.17
R0071:Ube3b UTSW 5 114419497 missense probably damaging 1.00
R0076:Ube3b UTSW 5 114408217 critical splice donor site probably null
R0076:Ube3b UTSW 5 114408217 critical splice donor site probably null
R0111:Ube3b UTSW 5 114390376 splice site probably benign
R0309:Ube3b UTSW 5 114419469 splice site probably benign
R0718:Ube3b UTSW 5 114402555 nonsense probably null
R1344:Ube3b UTSW 5 114418575 missense probably damaging 1.00
R1350:Ube3b UTSW 5 114406137 intron probably null
R1418:Ube3b UTSW 5 114418575 missense probably damaging 1.00
R1732:Ube3b UTSW 5 114387445 missense probably benign 0.01
R1764:Ube3b UTSW 5 114404617 missense possibly damaging 0.89
R1975:Ube3b UTSW 5 114399865 missense possibly damaging 0.80
R2014:Ube3b UTSW 5 114411149 missense probably damaging 1.00
R2015:Ube3b UTSW 5 114411149 missense probably damaging 1.00
R2041:Ube3b UTSW 5 114387233 missense probably damaging 0.99
R2074:Ube3b UTSW 5 114415255 missense probably benign 0.14
R2202:Ube3b UTSW 5 114389074 missense probably damaging 1.00
R2205:Ube3b UTSW 5 114389074 missense probably damaging 1.00
R3826:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3829:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3830:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3927:Ube3b UTSW 5 114415680 missense probably benign 0.03
R3974:Ube3b UTSW 5 114412430 missense probably benign 0.05
R4049:Ube3b UTSW 5 114412870 missense probably benign 0.09
R4096:Ube3b UTSW 5 114393086 missense possibly damaging 0.65
R4261:Ube3b UTSW 5 114398428 missense possibly damaging 0.80
R4415:Ube3b UTSW 5 114412444 missense probably damaging 1.00
R4688:Ube3b UTSW 5 114393078 missense probably benign 0.03
R4779:Ube3b UTSW 5 114404717 splice site probably null
R4824:Ube3b UTSW 5 114415726 intron probably null
R4868:Ube3b UTSW 5 114398427 missense probably benign 0.00
R4953:Ube3b UTSW 5 114401410 missense probably benign 0.01
R5013:Ube3b UTSW 5 114407641 missense probably damaging 1.00
R5057:Ube3b UTSW 5 114406257 missense probably benign 0.01
R5117:Ube3b UTSW 5 114419631 missense probably damaging 0.96
R5131:Ube3b UTSW 5 114407546 missense probably damaging 1.00
R5498:Ube3b UTSW 5 114418574 missense probably damaging 1.00
R5564:Ube3b UTSW 5 114389075 missense probably damaging 1.00
R5572:Ube3b UTSW 5 114406179 missense probably damaging 0.99
R5580:Ube3b UTSW 5 114415323 missense probably benign
R5596:Ube3b UTSW 5 114406160 splice site probably null
R5843:Ube3b UTSW 5 114412299 missense probably damaging 1.00
R5910:Ube3b UTSW 5 114415309 missense possibly damaging 0.63
R6591:Ube3b UTSW 5 114408124 missense probably benign 0.00
R6691:Ube3b UTSW 5 114408124 missense probably benign 0.00
R7148:Ube3b UTSW 5 114406252 missense probably damaging 0.97
R7334:Ube3b UTSW 5 114415681 missense possibly damaging 0.64
R7438:Ube3b UTSW 5 114415284 missense possibly damaging 0.79
R7438:Ube3b UTSW 5 114418626 missense probably damaging 1.00
X0017:Ube3b UTSW 5 114415585 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AGACACTAGATGGTCCTCCACTTCC -3'
(R):5'- TGCTGATGGCATAGCGTAGTTTCTC -3'

Sequencing Primer
(F):5'- GTCTTAGTTGACCTAGAACAGGACTC -3'
(R):5'- ATAGCGTAGTTTCTCTCGCAG -3'
Posted On2013-05-29