Mutagenetix > Incidental Mutations

Incidental Mutation 'R0071:Ube3b'

43842

Institutional Source

Beutler Lab

Gene Symbol

Ube3b

Ensembl Gene

ENSMUSG00000029577

Gene Name

ubiquitin protein ligase E3B

Synonyms

MMRRC Submission

038362-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0071 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

114380607-114421169 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 114419497 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 1014 (G1014D)

Ref Sequence

ENSEMBL: ENSMUSP00000073652 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]

Predicted Effect

probably damaging
Transcript: ENSMUST00000074002
AA Change: G1014D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: G1014D

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART
low complexity region	310	327	N/A	INTRINSIC
low complexity region	412	428	N/A	INTRINSIC
low complexity region	470	488	N/A	INTRINSIC
HECTc	697	1070	2.15e-110	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130169

SMART Domains

Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000196651

SMART Domains

Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
HECTc	122	495	1.1e-112	SMART

Meta Mutation Damage Score

0.604

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 92.2%

Validation Efficiency

99% (78/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900011O08Rik	A	G	16: 14,088,954	D11G	probably damaging	Het
4930474N05Rik	A	G	14: 36,090,789		probably benign	Het
Acot12	T	C	13: 91,781,174		probably benign	Het
Acrbp	T	C	6: 125,050,952		probably benign	Het
AI481877	A	G	4: 59,059,643	Y1006H	possibly damaging	Het
Amotl1	G	A	9: 14,548,773	A890V	probably benign	Het
Aox3	T	A	1: 58,171,891	C931*	probably null	Het
Apob	T	A	12: 8,002,111	V1184E	probably damaging	Het
Arhgap44	A	T	11: 65,011,895	L582Q	possibly damaging	Het
Bbx	C	T	16: 50,280,392	E47K	probably benign	Het
Bccip	A	G	7: 133,714,231	D72G	probably damaging	Het
Bckdha	A	T	7: 25,630,443		probably null	Het
Cald1	C	T	6: 34,758,134		probably benign	Het
Cdk11b	T	C	4: 155,649,423		probably benign	Het
Cebpe	G	T	14: 54,710,604	R261S	probably damaging	Het
Cep95	C	T	11: 106,790,728		probably benign	Het
Chil1	T	C	1: 134,185,279	Y150H	probably benign	Het
Chrnd	T	C	1: 87,192,837		probably benign	Het
Clec4g	T	A	8: 3,717,489		probably benign	Het
Cog2	T	C	8: 124,548,668		probably benign	Het
Coro7	A	T	16: 4,670,527	L93Q	probably damaging	Het
Csmd3	T	C	15: 47,596,821	T3525A	probably benign	Het
Ctsc	G	A	7: 88,308,149		probably benign	Het
Dnajc16	T	C	4: 141,768,007	T467A	probably benign	Het
Dnmt1	G	A	9: 20,908,620	T1409I	probably damaging	Het
Fam227b	T	A	2: 126,124,074	N144Y	probably benign	Het
Fam83h	A	G	15: 76,002,528	S987P	probably benign	Het
Fhod1	A	T	8: 105,337,225		probably null	Het
Folr1	A	G	7: 101,863,923		probably null	Het
Glis3	C	T	19: 28,263,855		probably benign	Het
Gm10069	T	C	6: 128,472,725		noncoding transcript	Het
Golgb1	G	A	16: 36,915,503	R1704Q	probably benign	Het
Gpr158	C	A	2: 21,810,668	T624K	probably benign	Het
Helz2	T	C	2: 181,236,407	Y866C	probably damaging	Het
Itpkb	T	A	1: 180,332,765	V152E	probably damaging	Het
Kcnma1	C	T	14: 23,526,767	R236H	probably damaging	Het
Klhl32	A	G	4: 24,743,907	V88A	probably damaging	Het
Lct	C	T	1: 128,292,018	W1631*	probably null	Het
Lipa	T	A	19: 34,495,082	K313M	probably damaging	Het
Ly75	T	C	2: 60,321,819	K1130R	probably benign	Het
Mamdc2	C	A	19: 23,303,630	E685*	probably null	Het
Mdm1	A	G	10: 118,146,796	E112G	probably damaging	Het
Metrnl	A	T	11: 121,716,000	M212L	probably benign	Het
Mettl2	A	G	11: 105,131,642		probably benign	Het
Mxd3	A	T	13: 55,329,636	L11Q	probably damaging	Het
Myo7a	A	T	7: 98,056,830	Y1836N	probably damaging	Het
Nsun7	A	G	5: 66,264,045	Y118C	probably benign	Het
Obscn	G	A	11: 59,064,201	T3962M	possibly damaging	Het
Olfr195	C	A	16: 59,149,215	R122S	probably benign	Het
Olfr53	A	T	7: 140,652,257	I93F	probably benign	Het
Olfr716	A	G	7: 107,147,712	Y132C	probably damaging	Het
Osbpl11	T	C	16: 33,214,338		probably benign	Het
Pcdhb22	A	T	18: 37,520,078	D276V	probably damaging	Het
Pik3cb	A	T	9: 99,044,865	D886E	probably benign	Het
Pkhd1	T	A	1: 20,201,344	Y2995F	probably benign	Het
Raver2	C	T	4: 101,120,445		probably benign	Het
Rhbdf1	A	G	11: 32,210,498	L684P	probably damaging	Het
Rufy2	C	A	10: 62,989,167	L75M	possibly damaging	Het
Sec22c	A	G	9: 121,692,913	F44L	probably damaging	Het
Sephs1	A	G	2: 4,899,560	T250A	probably benign	Het
Serpina1a	T	C	12: 103,855,743	K310R	probably benign	Het
Sobp	A	G	10: 43,157,997	L111P	probably damaging	Het
Sparcl1	G	T	5: 104,085,841	Y547*	probably null	Het
Spata31d1b	G	A	13: 59,715,349	A104T	probably benign	Het
Spert	A	G	14: 75,584,181	S44P	probably benign	Het
Spsb3	A	G	17: 24,887,904	D184G	probably damaging	Het
Sptan1	A	T	2: 30,003,342	K1148*	probably null	Het
Tdrd12	A	G	7: 35,529,246	V17A	possibly damaging	Het
Tlr9	A	G	9: 106,223,578	T23A	probably benign	Het
Tra2b	A	T	16: 22,254,401		probably benign	Het
Tspan15	A	G	10: 62,203,070		probably benign	Het
Ttc41	A	G	10: 86,736,846	N694S	probably benign	Het
Ttn	T	G	2: 76,767,469	D19700A	probably damaging	Het
Unc5d	A	G	8: 28,719,826	V422A	possibly damaging	Het
Vmn2r80	C	T	10: 79,171,732	T514I	possibly damaging	Het
Zfp595	T	C	13: 67,316,853	K452E	possibly damaging	Het
Zfp607a	A	G	7: 27,878,269	K255E	probably damaging	Het
Zxdc	T	G	6: 90,370,416	V253G	probably damaging	Het

Other mutations in Ube3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Ube3b	APN	5	114415287	missense	possibly damaging	0.93
IGL01154:Ube3b	APN	5	114406252	missense	probably null	0.86
IGL02632:Ube3b	APN	5	114398841	missense	probably benign
IGL02850:Ube3b	APN	5	114406249	missense	probably damaging	1.00
IGL02878:Ube3b	APN	5	114404717	splice site	probably null
IGL02881:Ube3b	APN	5	114412884	missense	possibly damaging	0.78
R0003:Ube3b	UTSW	5	114398851	missense	probably benign	0.17
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0111:Ube3b	UTSW	5	114390376	splice site	probably benign
R0309:Ube3b	UTSW	5	114419469	splice site	probably benign
R0718:Ube3b	UTSW	5	114402555	nonsense	probably null
R1344:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1350:Ube3b	UTSW	5	114406137	intron	probably null
R1418:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1732:Ube3b	UTSW	5	114387445	missense	probably benign	0.01
R1764:Ube3b	UTSW	5	114404617	missense	possibly damaging	0.89
R1975:Ube3b	UTSW	5	114399865	missense	possibly damaging	0.80
R2014:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2015:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2041:Ube3b	UTSW	5	114387233	missense	probably damaging	0.99
R2074:Ube3b	UTSW	5	114415255	missense	probably benign	0.14
R2202:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R2205:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R3826:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3829:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3830:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3927:Ube3b	UTSW	5	114415680	missense	probably benign	0.03
R3974:Ube3b	UTSW	5	114412430	missense	probably benign	0.05
R4049:Ube3b	UTSW	5	114412870	missense	probably benign	0.09
R4096:Ube3b	UTSW	5	114393086	missense	possibly damaging	0.65
R4261:Ube3b	UTSW	5	114398428	missense	possibly damaging	0.80
R4415:Ube3b	UTSW	5	114412444	missense	probably damaging	1.00
R4688:Ube3b	UTSW	5	114393078	missense	probably benign	0.03
R4779:Ube3b	UTSW	5	114404717	splice site	probably null
R4824:Ube3b	UTSW	5	114415726	intron	probably null
R4868:Ube3b	UTSW	5	114398427	missense	probably benign	0.00
R4953:Ube3b	UTSW	5	114401410	missense	probably benign	0.01
R5013:Ube3b	UTSW	5	114407641	missense	probably damaging	1.00
R5057:Ube3b	UTSW	5	114406257	missense	probably benign	0.01
R5117:Ube3b	UTSW	5	114419631	missense	probably damaging	0.96
R5131:Ube3b	UTSW	5	114407546	missense	probably damaging	1.00
R5498:Ube3b	UTSW	5	114418574	missense	probably damaging	1.00
R5564:Ube3b	UTSW	5	114389075	missense	probably damaging	1.00
R5572:Ube3b	UTSW	5	114406179	missense	probably damaging	0.99
R5580:Ube3b	UTSW	5	114415323	missense	probably benign
R5596:Ube3b	UTSW	5	114406160	splice site	probably null
R5843:Ube3b	UTSW	5	114412299	missense	probably damaging	1.00
R5910:Ube3b	UTSW	5	114415309	missense	possibly damaging	0.63
R6591:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R6691:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R7148:Ube3b	UTSW	5	114406252	missense	probably damaging	0.97
R7334:Ube3b	UTSW	5	114415681	missense	possibly damaging	0.64
R7438:Ube3b	UTSW	5	114415284	missense	possibly damaging	0.79
R7438:Ube3b	UTSW	5	114418626	missense	probably damaging	1.00
X0017:Ube3b	UTSW	5	114415585	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- AGACACTAGATGGTCCTCCACTTCC -3'
(R):5'- TGCTGATGGCATAGCGTAGTTTCTC -3'

Sequencing Primer
(F):5'- GTCTTAGTTGACCTAGAACAGGACTC -3'
(R):5'- ATAGCGTAGTTTCTCTCGCAG -3'

Posted On

2013-05-29