Mutagenetix > Incidental Mutation

Incidental Mutation 'R5580:Gphn'

438426

Institutional Source

Beutler Lab

Gene Symbol

Gphn

Ensembl Gene

ENSMUSG00000047454

Gene Name

gephyrin

Synonyms

5730552E08Rik, geph

MMRRC Submission

043134-MU

Accession Numbers

Genbank: NM_145965, NM_172952; MGI: 109602

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5580 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

78226379-78684772 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 78492044 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 155 (F155I)

Ref Sequence

ENSEMBL: ENSMUSP00000054064 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052472] [ENSMUST00000110388]

AlphaFold

Q8BUV3

Predicted Effect

probably damaging
Transcript: ENSMUST00000052472
AA Change: F155I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000054064
Gene: ENSMUSG00000047454
AA Change: F155I

Domain	Start	End	E-Value	Type
MoCF_biosynth	18	165	4.52e-27	SMART
low complexity region	186	201	N/A	INTRINSIC
Pfam:MoeA_N	356	522	5.6e-53	PFAM
MoCF_biosynth	535	678	8.1e-38	SMART
Pfam:MoeA_C	691	766	8.9e-26	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110388
AA Change: F155I

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000106018
Gene: ENSMUSG00000047454
AA Change: F155I

Domain	Start	End	E-Value	Type
MoCF_biosynth	18	165	4.52e-27	SMART
low complexity region	186	201	N/A	INTRINSIC
Pfam:MoeA_N	360	525	2.1e-35	PFAM
MoCF_biosynth	538	681	8.1e-38	SMART
Pfam:MoeA_C	694	769	8.1e-26	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a neuronal assembly protein that anchors inhibitory neurotransmitter receptors to the postsynaptic cytoskeleton via high affinity binding to a receptor subunit domain and tubulin dimers. In nonneuronal tissues, the encoded protein is also required for molybdenum cofactor biosynthesis. Mutations in this gene may be associated with the neurological condition hyperplexia and also lead to molybdenum cofactor deficiency. Numerous alternatively spliced transcript variants encoding different isoforms have been described; however, the full-length nature of all transcript variants is not currently known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die within one day of birth, apparently due to an inability to suckle. Apnea also develops within 12 hours of birth. [provided by MGI curators]

Allele List at MGI

All alleles(11) : Targeted, knock-out(1) Gene trapped(10)

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	T	13: 59,742,256	D583E	probably benign	Het
2410002F23Rik	A	G	7: 44,251,240	T73A	possibly damaging	Het
A1bg	A	T	15: 60,919,032	V365E	probably benign	Het
Abcg5	A	C	17: 84,660,154	V406G	probably damaging	Het
Adamts12	A	G	15: 11,152,000	Y192C	probably benign	Het
Add3	C	T	19: 53,245,211	S649L	probably damaging	Het
Adgrg6	A	T	10: 14,410,484	C1129*	probably null	Het
Arsb	T	A	13: 93,807,545	V248D	probably damaging	Het
AW554918	A	T	18: 25,339,865	N39I	probably damaging	Het
Cacna1b	A	T	2: 24,650,554	I1383N	probably damaging	Het
Caprin2	A	T	6: 148,858,734	V625D	possibly damaging	Het
Cd9	A	G	6: 125,464,457	L67P	probably damaging	Het
Cdh5	T	A	8: 104,125,494	Y80*	probably null	Het
Csf2ra	A	G	19: 61,226,217	L223P	probably damaging	Het
Cyp2c67	T	C	19: 39,615,650	K421E	probably damaging	Het
Dzank1	T	C	2: 144,506,178	R223G	probably damaging	Het
Emilin2	A	G	17: 71,275,230	V167A	probably benign	Het
Eps8l3	A	G	3: 107,881,603	T81A	probably damaging	Het
Esrra	T	C	19: 6,920,387	M1V	probably null	Het
Evpl	C	A	11: 116,234,232	A135S	probably benign	Het
Fam193a	A	G	5: 34,420,788	I209V	probably benign	Het
Fbxl19	C	A	7: 127,750,996	C253*	probably null	Het
Fer1l5	T	A	1: 36,385,458	Y305*	probably null	Het
Fzd2	A	C	11: 102,605,839	I370L	probably damaging	Het
Gm8882	T	C	6: 132,361,469	N262S	unknown	Het
Gnl3	T	C	14: 31,015,285	K212R	probably benign	Het
Golm1	A	G	13: 59,642,365	L207P	probably benign	Het
Grhl1	G	A	12: 24,609,740	G500S	probably benign	Het
Gucd1	C	A	10: 75,511,134	G55V	possibly damaging	Het
Haus6	A	T	4: 86,599,266	I287K	possibly damaging	Het
Hmcn1	G	A	1: 150,577,539	P5342S	probably benign	Het
Hspa12a	A	G	19: 58,799,660	S577P	probably benign	Het
Ido2	T	A	8: 24,550,866	I113F	possibly damaging	Het
Ifrd2	C	T	9: 107,592,312	P396S	probably damaging	Het
Igkv4-86	T	A	6: 68,911,006		probably benign	Het
Ipo11	A	G	13: 106,900,747	V196A	probably benign	Het
Itih2	T	C	2: 10,123,476	E138G	probably damaging	Het
Kidins220	T	G	12: 25,047,897	C1179G	probably benign	Het
Kif20b	T	A	19: 34,949,728		probably null	Het
Klk1	T	A	7: 44,228,814	Y63N	probably benign	Het
L3mbtl3	T	G	10: 26,303,706	D517A	unknown	Het
Lars	G	T	18: 42,214,851	P969H	probably damaging	Het
Lrp1	C	T	10: 127,588,520	V766I	probably benign	Het
Lrrc8c	A	G	5: 105,607,687	I443V	probably benign	Het
Lsg1	T	C	16: 30,569,167	M439V	probably null	Het
Magi2	T	A	5: 20,215,424	M286K	probably benign	Het
Med11	T	C	11: 70,452,065		probably null	Het
Med13l	A	G	5: 118,751,630	K1819E	possibly damaging	Het
Ms4a14	T	A	19: 11,303,226	Q656L	probably benign	Het
Muc5b	A	G	7: 141,861,347	T2677A	possibly damaging	Het
Myo7a	A	T	7: 98,073,160	L1186H	probably damaging	Het
Naca	C	A	10: 128,040,593		probably benign	Het
Nbeal1	T	C	1: 60,242,602	I828T	probably benign	Het
Ncor1	A	T	11: 62,389,778	C75*	probably null	Het
Nepn	A	C	10: 52,404,302	S497R	probably damaging	Het
Nf2	A	G	11: 4,803,689	F222L	probably damaging	Het
Nlrp9b	A	C	7: 20,023,164	T109P	probably damaging	Het
Nr1h4	A	T	10: 89,516,440	F22I	probably benign	Het
Ogg1	A	G	6: 113,329,376	Y178C	probably damaging	Het
Olfr1162	A	T	2: 88,050,324	M100K	possibly damaging	Het
Olfr1271	C	A	2: 90,266,350	V27L	probably benign	Het
Olfr1444	G	A	19: 12,861,804	V10M	possibly damaging	Het
Olfr1475	T	A	19: 13,479,427	Y257F	probably damaging	Het
Olfr381	G	T	11: 73,486,210	P205T	probably benign	Het
Osr1	G	A	12: 9,579,325	R66Q	probably damaging	Het
Pi4ka	A	G	16: 17,281,087	S1978P	probably damaging	Het
Pik3c2g	A	T	6: 139,626,533	Q239L	probably damaging	Het
Pin1rt1	A	G	2: 104,714,325	I154T	probably damaging	Het
Pkdcc	A	G	17: 83,220,082	T230A	probably damaging	Het
Por	A	T	5: 135,733,821	I430F	probably damaging	Het
Prkcsh	T	A	9: 22,011,255		probably null	Het
Pros1	A	G	16: 62,926,326		probably null	Het
Pus10	T	A	11: 23,672,556	L59I	probably benign	Het
Pxmp2	A	G	5: 110,283,676	V67A	possibly damaging	Het
Rab3gap1	C	A	1: 127,930,990	A612E	probably benign	Het
Rpap2	A	G	5: 107,620,145	E206G	probably benign	Het
Rpl31	C	T	1: 39,370,027	R41C	probably benign	Het
Ryr3	C	T	2: 112,841,948	G1393R	probably damaging	Het
Scara5	T	C	14: 65,731,079	M267T	probably benign	Het
Sema5a	A	T	15: 32,574,885	I380F	probably benign	Het
Slc36a3	A	G	11: 55,135,453	S180P	probably benign	Het
Slc44a5	A	G	3: 154,261,285	K536R	probably benign	Het
Smg1	T	C	7: 118,148,902		probably benign	Het
Strc	T	C	2: 121,375,012	K879R	probably damaging	Het
Swt1	T	C	1: 151,384,455	E731G	probably benign	Het
Syngap1	G	A	17: 26,962,331	A9T	probably damaging	Het
Tex15	C	T	8: 33,572,429	T903I	probably damaging	Het
Tg	A	G	15: 66,685,300	I937V	possibly damaging	Het
Tm9sf4	T	C	2: 153,182,430	Y58H	probably damaging	Het
Tsen2	A	T	6: 115,577,980	D458V	probably damaging	Het
Ttn	T	A	2: 76,917,802	D4301V	probably benign	Het
Txk	C	A	5: 72,707,589	L314F	probably damaging	Het
Ube3b	A	G	5: 114,415,323	T919A	probably benign	Het
Ubn2	A	G	6: 38,483,252	M641V	probably damaging	Het
Usp4	C	T	9: 108,365,859	T242I	probably benign	Het
Usp53	A	G	3: 122,934,234	S900P	probably benign	Het
Vmn1r225	T	C	17: 20,502,839	Y181H	probably damaging	Het
Vmn1r83	T	A	7: 12,321,873	I86L	probably benign	Het
Vmn2r65	T	C	7: 84,947,594	I84M	probably damaging	Het
Vstm2b	A	G	7: 40,902,626	H126R	probably damaging	Het
Zfp524	A	T	7: 5,018,417	I315F	probably benign	Het
Zfp975	A	T	7: 42,665,089	L20*	probably null	Het

Other mutations in Gphn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00338:Gphn	APN	12	78504632	missense	probably damaging	1.00
IGL00701:Gphn	APN	12	78626167	missense	possibly damaging	0.93
IGL00844:Gphn	APN	12	78664568	splice site	probably benign
IGL01517:Gphn	APN	12	78376374	missense	probably damaging	1.00
IGL02499:Gphn	APN	12	78492300	missense	probably benign	0.17
IGL02827:Gphn	APN	12	78609220	missense	probably damaging	1.00
IGL03136:Gphn	APN	12	78481333	missense	possibly damaging	0.69
IGL03348:Gphn	APN	12	78627119	missense	probably damaging	0.99
IGL03382:Gphn	APN	12	78481313	missense	probably damaging	1.00
grizzlies	UTSW	12	78654880	missense	probably benign	0.28
3-1:Gphn	UTSW	12	78613001	missense	probably benign	0.06
R0054:Gphn	UTSW	12	78637503	missense	probably damaging	1.00
R0054:Gphn	UTSW	12	78637503	missense	probably damaging	1.00
R0212:Gphn	UTSW	12	78637552	missense	probably damaging	0.99
R0389:Gphn	UTSW	12	78590659	missense	probably damaging	1.00
R0535:Gphn	UTSW	12	78492050	missense	possibly damaging	0.90
R1464:Gphn	UTSW	12	78612964	splice site	probably benign
R1503:Gphn	UTSW	12	78504629	missense	possibly damaging	0.94
R1606:Gphn	UTSW	12	78683883	missense	probably damaging	1.00
R1896:Gphn	UTSW	12	78412354	missense	possibly damaging	0.74
R2248:Gphn	UTSW	12	78454821	missense	probably damaging	1.00
R3708:Gphn	UTSW	12	78532693	missense	probably benign
R3907:Gphn	UTSW	12	78493942	splice site	probably benign
R4537:Gphn	UTSW	12	78494014	missense	probably benign	0.03
R4667:Gphn	UTSW	12	78454817	missense	probably damaging	1.00
R4808:Gphn	UTSW	12	78654880	missense	probably benign	0.28
R4840:Gphn	UTSW	12	78522955	critical splice donor site	probably null
R4852:Gphn	UTSW	12	78627210	missense	probably damaging	1.00
R4854:Gphn	UTSW	12	78627210	missense	probably damaging	1.00
R4855:Gphn	UTSW	12	78627210	missense	probably damaging	1.00
R5083:Gphn	UTSW	12	78623289	splice site	probably null
R5224:Gphn	UTSW	12	78590587	missense	probably damaging	0.99
R5626:Gphn	UTSW	12	78683897	missense	probably benign	0.11
R6270:Gphn	UTSW	12	78522950	missense	probably benign
R6563:Gphn	UTSW	12	78680396	critical splice donor site	probably null
R6943:Gphn	UTSW	12	78492181	missense	possibly damaging	0.88
R6958:Gphn	UTSW	12	78680299	missense	possibly damaging	0.86
R7170:Gphn	UTSW	12	78683889	missense	possibly damaging	0.67
R7295:Gphn	UTSW	12	78492102	missense	probably benign	0.02
R7514:Gphn	UTSW	12	78626165	missense	probably damaging	0.97
R7537:Gphn	UTSW	12	78504680	missense	possibly damaging	0.62
R7680:Gphn	UTSW	12	78412374	missense	probably benign	0.14
R8236:Gphn	UTSW	12	78664537	missense	probably damaging	1.00
R8377:Gphn	UTSW	12	78664506	missense	probably damaging	1.00
R8409:Gphn	UTSW	12	78613010	missense	probably damaging	1.00
R8468:Gphn	UTSW	12	78226827	missense	probably benign	0.22
R8742:Gphn	UTSW	12	78612992	missense	probably damaging	1.00
R8832:Gphn	UTSW	12	78412400	synonymous	silent
R8845:Gphn	UTSW	12	78492179	missense	probably benign	0.30
R8972:Gphn	UTSW	12	78609239	critical splice donor site	probably null
R9254:Gphn	UTSW	12	78627262	critical splice donor site	probably null
R9287:Gphn	UTSW	12	78562872	missense	possibly damaging	0.68
R9355:Gphn	UTSW	12	78492194	missense	probably damaging	0.97
R9536:Gphn	UTSW	12	78562862	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- AGGCACCAGAACCTTTAACATATG -3'
(R):5'- TCTGTTGAAGCTACACCACTG -3'

Sequencing Primer
(F):5'- GGTGGCGACAAATGCCTTTAATCC -3'
(R):5'- GTTGAAGCTACACCACTGTCTTTC -3'

Posted On

2016-10-26