Mutagenetix > Incidental Mutations

Incidental Mutation 'R5580:Adamts12'

438433

Institutional Source

Beutler Lab

Gene Symbol

Adamts12

Ensembl Gene

ENSMUSG00000047497

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12

Synonyms

AI605170; ADAMTS-12

MMRRC Submission

043134-MU

Accession Numbers

Genbank: NM_175501.2; MGI:2146046

Is this an essential gene?

Probably non essential (E-score: 0.090) question?

Stock #

R5580 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

11064790-11349231 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 11152000 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 192 (Y192C)

Ref Sequence

ENSEMBL: ENSMUSP00000057796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061318]

Predicted Effect

probably benign
Transcript: ENSMUST00000061318
AA Change: Y192C

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: Y192C

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Pep_M12B_propep	53	197	5.5e-30	PFAM
low complexity region	236	245	N/A	INTRINSIC
Pfam:Reprolysin_5	248	438	1.6e-14	PFAM
Pfam:Reprolysin_4	248	453	6.7e-8	PFAM
Pfam:Reprolysin	250	460	1.2e-27	PFAM
Pfam:Reprolysin_2	268	450	5.5e-11	PFAM
Pfam:Reprolysin_3	272	407	3.5e-10	PFAM
TSP1	549	601	9.29e-14	SMART
Pfam:ADAM_spacer1	706	817	4.8e-36	PFAM
TSP1	831	887	4.66e-5	SMART
TSP1	890	949	2.54e-1	SMART
TSP1	951	1001	8.95e-7	SMART
low complexity region	1032	1047	N/A	INTRINSIC
low complexity region	1130	1141	N/A	INTRINSIC
TSP1	1321	1371	2.22e-2	SMART
TSP1	1372	1431	9.97e-2	SMART
TSP1	1432	1479	1.19e-2	SMART
TSP1	1480	1538	2.63e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227189

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228940

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	T	13: 59,742,256	D583E	probably benign	Het
2410002F23Rik	A	G	7: 44,251,240	T73A	possibly damaging	Het
A1bg	A	T	15: 60,919,032	V365E	probably benign	Het
Abcg5	A	C	17: 84,660,154	V406G	probably damaging	Het
Add3	C	T	19: 53,245,211	S649L	probably damaging	Het
Adgrg6	A	T	10: 14,410,484	C1129*	probably null	Het
Arsb	T	A	13: 93,807,545	V248D	probably damaging	Het
AW554918	A	T	18: 25,339,865	N39I	probably damaging	Het
Cacna1b	A	T	2: 24,650,554	I1383N	probably damaging	Het
Caprin2	A	T	6: 148,858,734	V625D	possibly damaging	Het
Cd9	A	G	6: 125,464,457	L67P	probably damaging	Het
Cdh5	T	A	8: 104,125,494	Y80*	probably null	Het
Csf2ra	A	G	19: 61,226,217	L223P	probably damaging	Het
Cyp2c67	T	C	19: 39,615,650	K421E	probably damaging	Het
Dzank1	T	C	2: 144,506,178	R223G	probably damaging	Het
Emilin2	A	G	17: 71,275,230	V167A	probably benign	Het
Eps8l3	A	G	3: 107,881,603	T81A	probably damaging	Het
Esrra	T	C	19: 6,920,387	M1V	probably null	Het
Evpl	C	A	11: 116,234,232	A135S	probably benign	Het
Fam193a	A	G	5: 34,420,788	I209V	probably benign	Het
Fbxl19	C	A	7: 127,750,996	C253*	probably null	Het
Fer1l5	T	A	1: 36,385,458	Y305*	probably null	Het
Fzd2	A	C	11: 102,605,839	I370L	probably damaging	Het
Gm8882	T	C	6: 132,361,469	N262S	unknown	Het
Gnl3	T	C	14: 31,015,285	K212R	probably benign	Het
Golm1	A	G	13: 59,642,365	L207P	probably benign	Het
Gphn	T	A	12: 78,492,044	F155I	probably damaging	Het
Grhl1	G	A	12: 24,609,740	G500S	probably benign	Het
Gucd1	C	A	10: 75,511,134	G55V	possibly damaging	Het
Haus6	A	T	4: 86,599,266	I287K	possibly damaging	Het
Hmcn1	G	A	1: 150,577,539	P5342S	probably benign	Het
Hspa12a	A	G	19: 58,799,660	S577P	probably benign	Het
Ido2	T	A	8: 24,550,866	I113F	possibly damaging	Het
Ifrd2	C	T	9: 107,592,312	P396S	probably damaging	Het
Igkv4-86	T	A	6: 68,911,006		probably benign	Het
Ipo11	A	G	13: 106,900,747	V196A	probably benign	Het
Itih2	T	C	2: 10,123,476	E138G	probably damaging	Het
Kidins220	T	G	12: 25,047,897	C1179G	probably benign	Het
Kif20b	T	A	19: 34,949,728		probably null	Het
Klk1	T	A	7: 44,228,814	Y63N	probably benign	Het
L3mbtl3	T	G	10: 26,303,706	D517A	unknown	Het
Lars	G	T	18: 42,214,851	P969H	probably damaging	Het
Lrp1	C	T	10: 127,588,520	V766I	probably benign	Het
Lrrc8c	A	G	5: 105,607,687	I443V	probably benign	Het
Lsg1	T	C	16: 30,569,167	M439V	probably null	Het
Magi2	T	A	5: 20,215,424	M286K	probably benign	Het
Med11	T	C	11: 70,452,065		probably null	Het
Med13l	A	G	5: 118,751,630	K1819E	possibly damaging	Het
Ms4a14	T	A	19: 11,303,226	Q656L	probably benign	Het
Muc5b	A	G	7: 141,861,347	T2677A	possibly damaging	Het
Myo7a	A	T	7: 98,073,160	L1186H	probably damaging	Het
Naca	C	A	10: 128,040,593		probably benign	Het
Nbeal1	T	C	1: 60,242,602	I828T	probably benign	Het
Ncor1	A	T	11: 62,389,778	C75*	probably null	Het
Nepn	A	C	10: 52,404,302	S497R	probably damaging	Het
Nf2	A	G	11: 4,803,689	F222L	probably damaging	Het
Nlrp9b	A	C	7: 20,023,164	T109P	probably damaging	Het
Nr1h4	A	T	10: 89,516,440	F22I	probably benign	Het
Ogg1	A	G	6: 113,329,376	Y178C	probably damaging	Het
Olfr1162	A	T	2: 88,050,324	M100K	possibly damaging	Het
Olfr1271	C	A	2: 90,266,350	V27L	probably benign	Het
Olfr1444	G	A	19: 12,861,804	V10M	possibly damaging	Het
Olfr1475	T	A	19: 13,479,427	Y257F	probably damaging	Het
Olfr381	G	T	11: 73,486,210	P205T	probably benign	Het
Osr1	G	A	12: 9,579,325	R66Q	probably damaging	Het
Pi4ka	A	G	16: 17,281,087	S1978P	probably damaging	Het
Pik3c2g	A	T	6: 139,626,533	Q239L	probably damaging	Het
Pin1rt1	A	G	2: 104,714,325	I154T	probably damaging	Het
Pkdcc	A	G	17: 83,220,082	T230A	probably damaging	Het
Por	A	T	5: 135,733,821	I430F	probably damaging	Het
Prkcsh	T	A	9: 22,011,255		probably null	Het
Pros1	A	G	16: 62,926,326		probably null	Het
Pus10	T	A	11: 23,672,556	L59I	probably benign	Het
Pxmp2	A	G	5: 110,283,676	V67A	possibly damaging	Het
Rab3gap1	C	A	1: 127,930,990	A612E	probably benign	Het
Rpap2	A	G	5: 107,620,145	E206G	probably benign	Het
Rpl31	C	T	1: 39,370,027	R41C	probably benign	Het
Ryr3	C	T	2: 112,841,948	G1393R	probably damaging	Het
Scara5	T	C	14: 65,731,079	M267T	probably benign	Het
Sema5a	A	T	15: 32,574,885	I380F	probably benign	Het
Slc36a3	A	G	11: 55,135,453	S180P	probably benign	Het
Slc44a5	A	G	3: 154,261,285	K536R	probably benign	Het
Smg1	T	C	7: 118,148,902		probably benign	Het
Strc	T	C	2: 121,375,012	K879R	probably damaging	Het
Swt1	T	C	1: 151,384,455	E731G	probably benign	Het
Syngap1	G	A	17: 26,962,331	A9T	probably damaging	Het
Tex15	C	T	8: 33,572,429	T903I	probably damaging	Het
Tg	A	G	15: 66,685,300	I937V	possibly damaging	Het
Tm9sf4	T	C	2: 153,182,430	Y58H	probably damaging	Het
Tsen2	A	T	6: 115,577,980	D458V	probably damaging	Het
Ttn	T	A	2: 76,917,802	D4301V	probably benign	Het
Txk	C	A	5: 72,707,589	L314F	probably damaging	Het
Ube3b	A	G	5: 114,415,323	T919A	probably benign	Het
Ubn2	A	G	6: 38,483,252	M641V	probably damaging	Het
Usp4	C	T	9: 108,365,859	T242I	probably benign	Het
Usp53	A	G	3: 122,934,234	S900P	probably benign	Het
Vmn1r225	T	C	17: 20,502,839	Y181H	probably damaging	Het
Vmn1r83	T	A	7: 12,321,873	I86L	probably benign	Het
Vmn2r65	T	C	7: 84,947,594	I84M	probably damaging	Het
Vstm2b	A	G	7: 40,902,626	H126R	probably damaging	Het
Zfp524	A	T	7: 5,018,417	I315F	probably benign	Het
Zfp975	A	T	7: 42,665,089	L20*	probably null	Het

Other mutations in Adamts12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Adamts12	APN	15	11311599	missense	probably benign	0.00
IGL00513:Adamts12	APN	15	11256961	missense	probably benign	0.28
IGL00579:Adamts12	APN	15	11152014	missense	probably benign	0.20
IGL00984:Adamts12	APN	15	11215610	missense	probably benign	0.01
IGL01307:Adamts12	APN	15	11237546	missense	possibly damaging	0.88
IGL01314:Adamts12	APN	15	11071853	missense	probably benign	0.30
IGL01353:Adamts12	APN	15	11292005	splice site	probably benign
IGL01373:Adamts12	APN	15	11310730	missense	probably benign	0.00
IGL01522:Adamts12	APN	15	11065159	critical splice donor site	probably null
IGL01589:Adamts12	APN	15	11311237	missense	probably benign	0.26
IGL01715:Adamts12	APN	15	11258096	missense	possibly damaging	0.47
IGL01966:Adamts12	APN	15	11258183	missense	probably damaging	0.98
IGL01994:Adamts12	APN	15	11345594	missense	probably damaging	1.00
IGL02058:Adamts12	APN	15	11215610	missense	probably benign	0.01
IGL02216:Adamts12	APN	15	11241485	missense	possibly damaging	0.63
IGL02252:Adamts12	APN	15	11311015	missense	probably benign	0.01
IGL02336:Adamts12	APN	15	11311245	missense	probably benign	0.02
IGL02445:Adamts12	APN	15	11286712	missense	probably damaging	1.00
IGL03115:Adamts12	APN	15	11263336	missense	probably damaging	1.00
IGL03131:Adamts12	APN	15	11345564	missense	probably damaging	1.00
IGL03161:Adamts12	APN	15	11292082	missense	possibly damaging	0.93
IGL03403:Adamts12	APN	15	11241488	missense	probably damaging	1.00
I2289:Adamts12	UTSW	15	11071808	missense	probably benign	0.13
PIT4677001:Adamts12	UTSW	15	11286810	missense	probably benign	0.33
R0016:Adamts12	UTSW	15	11217829	missense	probably damaging	1.00
R0016:Adamts12	UTSW	15	11217829	missense	probably damaging	1.00
R0027:Adamts12	UTSW	15	11285873	missense	probably damaging	0.99
R0027:Adamts12	UTSW	15	11285873	missense	probably damaging	0.99
R0028:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0108:Adamts12	UTSW	15	11311098	missense	probably benign	0.08
R0108:Adamts12	UTSW	15	11311098	missense	probably benign	0.08
R0122:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0196:Adamts12	UTSW	15	11071508	missense	probably benign	0.11
R0308:Adamts12	UTSW	15	11311560	missense	probably damaging	0.98
R0335:Adamts12	UTSW	15	11311058	missense	possibly damaging	0.95
R0667:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0729:Adamts12	UTSW	15	11255683	missense	possibly damaging	0.91
R1162:Adamts12	UTSW	15	11277458	critical splice donor site	probably null
R1173:Adamts12	UTSW	15	11071757	missense	probably benign
R1174:Adamts12	UTSW	15	11071757	missense	probably benign
R1319:Adamts12	UTSW	15	11286791	missense	probably benign	0.02
R1344:Adamts12	UTSW	15	11286804	missense	probably damaging	1.00
R1367:Adamts12	UTSW	15	11256894	splice site	probably benign
R1396:Adamts12	UTSW	15	11311472	missense	probably benign	0.01
R1418:Adamts12	UTSW	15	11286804	missense	probably damaging	1.00
R1447:Adamts12	UTSW	15	11263361	missense	probably benign	0.42
R1466:Adamts12	UTSW	15	11311359	missense	probably benign
R1466:Adamts12	UTSW	15	11311359	missense	probably benign
R1599:Adamts12	UTSW	15	11071711	missense	probably damaging	0.99
R1700:Adamts12	UTSW	15	11152057	missense	probably benign	0.00
R1748:Adamts12	UTSW	15	11241462	missense	probably damaging	0.99
R1826:Adamts12	UTSW	15	11071520	missense	probably benign	0.06
R1870:Adamts12	UTSW	15	11311154	missense	probably benign	0.06
R1871:Adamts12	UTSW	15	11311154	missense	probably benign	0.06
R1872:Adamts12	UTSW	15	11217880	nonsense	probably null
R1931:Adamts12	UTSW	15	11270599	missense	probably benign	0.00
R2041:Adamts12	UTSW	15	11215735	missense	probably damaging	1.00
R2119:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2120:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2122:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2161:Adamts12	UTSW	15	11215735	missense	probably damaging	0.99
R2655:Adamts12	UTSW	15	11065088	missense	possibly damaging	0.50
R4010:Adamts12	UTSW	15	11286083	missense	possibly damaging	0.69
R4208:Adamts12	UTSW	15	11071754	missense	probably benign
R4666:Adamts12	UTSW	15	11311492	missense	probably benign	0.08
R4731:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4732:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4733:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4766:Adamts12	UTSW	15	11285901	missense	probably benign	0.03
R4877:Adamts12	UTSW	15	11327701	missense	probably damaging	1.00
R4929:Adamts12	UTSW	15	11259022	missense	probably damaging	0.96
R5060:Adamts12	UTSW	15	11299968	missense	probably damaging	1.00
R5145:Adamts12	UTSW	15	11285876	missense	probably damaging	1.00
R5191:Adamts12	UTSW	15	11327757	missense	probably benign	0.18
R5492:Adamts12	UTSW	15	11336298	missense	probably benign	0.05
R5645:Adamts12	UTSW	15	11277420	missense	possibly damaging	0.92
R5724:Adamts12	UTSW	15	11286750	missense	probably benign	0.15
R6240:Adamts12	UTSW	15	11285958	missense	probably benign	0.44
R6331:Adamts12	UTSW	15	11241433	missense	probably damaging	1.00
R6381:Adamts12	UTSW	15	11256994	missense	possibly damaging	0.93
R6393:Adamts12	UTSW	15	11255635	missense	probably damaging	0.97
R6419:Adamts12	UTSW	15	11215673	missense	possibly damaging	0.72
R6571:Adamts12	UTSW	15	11065101	missense	probably benign	0.00
R6821:Adamts12	UTSW	15	11152048	missense	probably benign	0.14
R6913:Adamts12	UTSW	15	11215692	missense	probably damaging	1.00
R6973:Adamts12	UTSW	15	11331780	nonsense	probably null
R7188:Adamts12	UTSW	15	11336325	nonsense	probably null
R7290:Adamts12	UTSW	15	11277366	missense	probably benign	0.08
R7307:Adamts12	UTSW	15	11217813	missense	probably damaging	1.00
R7376:Adamts12	UTSW	15	11277339	missense	possibly damaging	0.69
R7419:Adamts12	UTSW	15	11317279	missense	probably benign	0.00
R7484:Adamts12	UTSW	15	11345648	missense	probably benign	0.25
R7562:Adamts12	UTSW	15	11270611	missense	probably benign	0.01
R7653:Adamts12	UTSW	15	11257029	missense	probably benign	0.28
R7696:Adamts12	UTSW	15	11258138	missense	probably damaging	1.00
R7957:Adamts12	UTSW	15	11317212	missense	possibly damaging	0.96
R7980:Adamts12	UTSW	15	11263337	missense	probably damaging	1.00
R7992:Adamts12	UTSW	15	11310818	missense	probably benign
R8032:Adamts12	UTSW	15	11259103	critical splice donor site	probably null
R8109:Adamts12	UTSW	15	11331791	missense	probably benign	0.02
R8402:Adamts12	UTSW	15	11263290	missense	probably damaging	0.96
R8751:Adamts12	UTSW	15	11215727	missense	probably damaging	1.00
R8782:Adamts12	UTSW	15	11237592	missense	probably damaging	1.00
R8934:Adamts12	UTSW	15	11299929	missense	probably damaging	0.99
R8952:Adamts12	UTSW	15	11285979	missense	probably damaging	1.00
R8963:Adamts12	UTSW	15	11317357	critical splice donor site	probably null
V1662:Adamts12	UTSW	15	11071808	missense	probably benign	0.13
X0022:Adamts12	UTSW	15	11277448	missense	probably benign	0.30
Z1176:Adamts12	UTSW	15	11336383	missense	not run
Z1177:Adamts12	UTSW	15	11317324	missense	probably damaging	1.00
Z1177:Adamts12	UTSW	15	11336383	missense	not run

Predicted Primers

PCR Primer
(F):5'- AGCACTGGTTCTGGGATTTCC -3'
(R):5'- ATAGGTTGCTTAGGCTAACTTTGAG -3'

Sequencing Primer
(F):5'- TGGGATTTCCAGAGATTACCAAGGTC -3'
(R):5'- AGTCATAGCTATGAGGCC -3'

Posted On

2016-10-26