Mutagenetix > Incidental Mutation

Incidental Mutation 'R5580:Tg'

438436

Institutional Source

Beutler Lab

Gene Symbol

Ensembl Gene

ENSMUSG00000053469

Gene Name

thyroglobulin

Synonyms

Tgn

MMRRC Submission

043134-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.110) question?

Stock #

R5580 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

66670753-66850721 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 66685300 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 937 (I937V)

Ref Sequence

ENSEMBL: ENSMUSP00000070239 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065916]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065916
AA Change: I937V

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469
AA Change: I937V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
TY	50	97	5.9e-16	SMART
TY	118	165	5.59e-17	SMART
Pfam:Thyroglobulin_1	174	252	4e-9	PFAM
TY	317	363	4.36e-19	SMART
low complexity region	495	504	N/A	INTRINSIC
TY	617	662	3.58e-15	SMART
TY	684	730	1.47e-16	SMART
TY	880	926	1.51e-4	SMART
TY	1029	1078	1.21e-12	SMART
TY	1106	1150	7.56e-5	SMART
TY	1167	1215	7.26e-16	SMART
low complexity region	1244	1255	N/A	INTRINSIC
Pfam:GCC2_GCC3	1464	1509	2.7e-16	PFAM
TY	1519	1568	9.81e-13	SMART
Pfam:COesterase	2181	2717	8.4e-140	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	T	13: 59,742,256	D583E	probably benign	Het
2410002F23Rik	A	G	7: 44,251,240	T73A	possibly damaging	Het
A1bg	A	T	15: 60,919,032	V365E	probably benign	Het
Abcg5	A	C	17: 84,660,154	V406G	probably damaging	Het
Adamts12	A	G	15: 11,152,000	Y192C	probably benign	Het
Add3	C	T	19: 53,245,211	S649L	probably damaging	Het
Adgrg6	A	T	10: 14,410,484	C1129*	probably null	Het
Arsb	T	A	13: 93,807,545	V248D	probably damaging	Het
AW554918	A	T	18: 25,339,865	N39I	probably damaging	Het
Cacna1b	A	T	2: 24,650,554	I1383N	probably damaging	Het
Caprin2	A	T	6: 148,858,734	V625D	possibly damaging	Het
Cd9	A	G	6: 125,464,457	L67P	probably damaging	Het
Cdh5	T	A	8: 104,125,494	Y80*	probably null	Het
Csf2ra	A	G	19: 61,226,217	L223P	probably damaging	Het
Cyp2c67	T	C	19: 39,615,650	K421E	probably damaging	Het
Dzank1	T	C	2: 144,506,178	R223G	probably damaging	Het
Emilin2	A	G	17: 71,275,230	V167A	probably benign	Het
Eps8l3	A	G	3: 107,881,603	T81A	probably damaging	Het
Esrra	T	C	19: 6,920,387	M1V	probably null	Het
Evpl	C	A	11: 116,234,232	A135S	probably benign	Het
Fam193a	A	G	5: 34,420,788	I209V	probably benign	Het
Fbxl19	C	A	7: 127,750,996	C253*	probably null	Het
Fer1l5	T	A	1: 36,385,458	Y305*	probably null	Het
Fzd2	A	C	11: 102,605,839	I370L	probably damaging	Het
Gm8882	T	C	6: 132,361,469	N262S	unknown	Het
Gnl3	T	C	14: 31,015,285	K212R	probably benign	Het
Golm1	A	G	13: 59,642,365	L207P	probably benign	Het
Gphn	T	A	12: 78,492,044	F155I	probably damaging	Het
Grhl1	G	A	12: 24,609,740	G500S	probably benign	Het
Gucd1	C	A	10: 75,511,134	G55V	possibly damaging	Het
Haus6	A	T	4: 86,599,266	I287K	possibly damaging	Het
Hmcn1	G	A	1: 150,577,539	P5342S	probably benign	Het
Hspa12a	A	G	19: 58,799,660	S577P	probably benign	Het
Ido2	T	A	8: 24,550,866	I113F	possibly damaging	Het
Ifrd2	C	T	9: 107,592,312	P396S	probably damaging	Het
Igkv4-86	T	A	6: 68,911,006		probably benign	Het
Ipo11	A	G	13: 106,900,747	V196A	probably benign	Het
Itih2	T	C	2: 10,123,476	E138G	probably damaging	Het
Kidins220	T	G	12: 25,047,897	C1179G	probably benign	Het
Kif20b	T	A	19: 34,949,728		probably null	Het
Klk1	T	A	7: 44,228,814	Y63N	probably benign	Het
L3mbtl3	T	G	10: 26,303,706	D517A	unknown	Het
Lars	G	T	18: 42,214,851	P969H	probably damaging	Het
Lrp1	C	T	10: 127,588,520	V766I	probably benign	Het
Lrrc8c	A	G	5: 105,607,687	I443V	probably benign	Het
Lsg1	T	C	16: 30,569,167	M439V	probably null	Het
Magi2	T	A	5: 20,215,424	M286K	probably benign	Het
Med11	T	C	11: 70,452,065		probably null	Het
Med13l	A	G	5: 118,751,630	K1819E	possibly damaging	Het
Ms4a14	T	A	19: 11,303,226	Q656L	probably benign	Het
Muc5b	A	G	7: 141,861,347	T2677A	possibly damaging	Het
Myo7a	A	T	7: 98,073,160	L1186H	probably damaging	Het
Naca	C	A	10: 128,040,593		probably benign	Het
Nbeal1	T	C	1: 60,242,602	I828T	probably benign	Het
Ncor1	A	T	11: 62,389,778	C75*	probably null	Het
Nepn	A	C	10: 52,404,302	S497R	probably damaging	Het
Nf2	A	G	11: 4,803,689	F222L	probably damaging	Het
Nlrp9b	A	C	7: 20,023,164	T109P	probably damaging	Het
Nr1h4	A	T	10: 89,516,440	F22I	probably benign	Het
Ogg1	A	G	6: 113,329,376	Y178C	probably damaging	Het
Olfr1162	A	T	2: 88,050,324	M100K	possibly damaging	Het
Olfr1271	C	A	2: 90,266,350	V27L	probably benign	Het
Olfr1444	G	A	19: 12,861,804	V10M	possibly damaging	Het
Olfr1475	T	A	19: 13,479,427	Y257F	probably damaging	Het
Olfr381	G	T	11: 73,486,210	P205T	probably benign	Het
Osr1	G	A	12: 9,579,325	R66Q	probably damaging	Het
Pi4ka	A	G	16: 17,281,087	S1978P	probably damaging	Het
Pik3c2g	A	T	6: 139,626,533	Q239L	probably damaging	Het
Pin1rt1	A	G	2: 104,714,325	I154T	probably damaging	Het
Pkdcc	A	G	17: 83,220,082	T230A	probably damaging	Het
Por	A	T	5: 135,733,821	I430F	probably damaging	Het
Prkcsh	T	A	9: 22,011,255		probably null	Het
Pros1	A	G	16: 62,926,326		probably null	Het
Pus10	T	A	11: 23,672,556	L59I	probably benign	Het
Pxmp2	A	G	5: 110,283,676	V67A	possibly damaging	Het
Rab3gap1	C	A	1: 127,930,990	A612E	probably benign	Het
Rpap2	A	G	5: 107,620,145	E206G	probably benign	Het
Rpl31	C	T	1: 39,370,027	R41C	probably benign	Het
Ryr3	C	T	2: 112,841,948	G1393R	probably damaging	Het
Scara5	T	C	14: 65,731,079	M267T	probably benign	Het
Sema5a	A	T	15: 32,574,885	I380F	probably benign	Het
Slc36a3	A	G	11: 55,135,453	S180P	probably benign	Het
Slc44a5	A	G	3: 154,261,285	K536R	probably benign	Het
Smg1	T	C	7: 118,148,902		probably benign	Het
Strc	T	C	2: 121,375,012	K879R	probably damaging	Het
Swt1	T	C	1: 151,384,455	E731G	probably benign	Het
Syngap1	G	A	17: 26,962,331	A9T	probably damaging	Het
Tex15	C	T	8: 33,572,429	T903I	probably damaging	Het
Tm9sf4	T	C	2: 153,182,430	Y58H	probably damaging	Het
Tsen2	A	T	6: 115,577,980	D458V	probably damaging	Het
Ttn	T	A	2: 76,917,802	D4301V	probably benign	Het
Txk	C	A	5: 72,707,589	L314F	probably damaging	Het
Ube3b	A	G	5: 114,415,323	T919A	probably benign	Het
Ubn2	A	G	6: 38,483,252	M641V	probably damaging	Het
Usp4	C	T	9: 108,365,859	T242I	probably benign	Het
Usp53	A	G	3: 122,934,234	S900P	probably benign	Het
Vmn1r225	T	C	17: 20,502,839	Y181H	probably damaging	Het
Vmn1r83	T	A	7: 12,321,873	I86L	probably benign	Het
Vmn2r65	T	C	7: 84,947,594	I84M	probably damaging	Het
Vstm2b	A	G	7: 40,902,626	H126R	probably damaging	Het
Zfp524	A	T	7: 5,018,417	I315F	probably benign	Het
Zfp975	A	T	7: 42,665,089	L20*	probably null	Het

Other mutations in Tg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Tg	APN	15	66847166	missense	probably damaging	1.00
IGL00230:Tg	APN	15	66827290	missense	probably benign	0.00
IGL00324:Tg	APN	15	66693424	missense	probably benign
IGL00428:Tg	APN	15	66773424	missense	probably benign	0.33
IGL00703:Tg	APN	15	66696489	missense	probably benign	0.34
IGL00808:Tg	APN	15	66683813	missense	probably damaging	1.00
IGL00833:Tg	APN	15	66688801	missense	probably benign	0.34
IGL00899:Tg	APN	15	66674073	critical splice donor site	probably null
IGL00921:Tg	APN	15	66764453	missense	probably benign	0.28
IGL00975:Tg	APN	15	66681882	missense	probably benign
IGL01288:Tg	APN	15	66736276	missense	possibly damaging	0.81
IGL01397:Tg	APN	15	66696092	splice site	probably benign
IGL01634:Tg	APN	15	66729566	missense	probably benign	0.34
IGL01646:Tg	APN	15	66678087	missense	probably damaging	1.00
IGL01704:Tg	APN	15	66671351	missense	probably damaging	0.98
IGL01958:Tg	APN	15	66759486	missense	probably benign	0.06
IGL02093:Tg	APN	15	66692374	missense	possibly damaging	0.83
IGL02113:Tg	APN	15	66705330	missense	probably benign	0.08
IGL02138:Tg	APN	15	66717233	missense	probably benign	0.01
IGL02156:Tg	APN	15	66705348	missense	probably benign	0.19
IGL02169:Tg	APN	15	66757943	missense	probably benign	0.04
IGL02342:Tg	APN	15	66764291	missense	probably benign
IGL02434:Tg	APN	15	66764342	missense	probably damaging	0.97
IGL02506:Tg	APN	15	66741594	missense	possibly damaging	0.71
IGL02513:Tg	APN	15	66705274	missense	probably benign
IGL02549:Tg	APN	15	66839361	missense	probably damaging	1.00
IGL02669:Tg	APN	15	66748726	splice site	probably benign
IGL02756:Tg	APN	15	66734586	missense	probably benign
IGL02800:Tg	APN	15	66757886	missense	probably damaging	1.00
IGL02828:Tg	APN	15	66682394	missense	probably damaging	1.00
IGL02927:Tg	APN	15	66678093	missense	probably damaging	1.00
IGL03061:Tg	APN	15	66671405	missense	probably damaging	1.00
IGL03105:Tg	APN	15	66715106	missense	probably benign	0.01
IGL03160:Tg	APN	15	66839303	nonsense	probably null
IGL03242:Tg	APN	15	66683798	missense	probably damaging	0.99
Also_ran	UTSW	15	66678839	missense	probably damaging	1.00
bedraggled	UTSW	15	66740714	missense	probably damaging	1.00
foster	UTSW	15	66693260	nonsense	probably null
hognose	UTSW	15	66717208	missense	probably damaging	0.99
ito	UTSW	15	66766162	nonsense	probably null
ito2	UTSW	15	66671396	missense	probably damaging	1.00
ito3	UTSW	15	66773474	missense	probably damaging	1.00
ito4	UTSW	15	66696520	missense	possibly damaging	0.47
Papua	UTSW	15	66674050	missense	probably damaging	1.00
Pipistrella	UTSW	15	66696135	missense	probably damaging	1.00
pluribus	UTSW	15	66715163	missense	probably damaging	0.98
samarai	UTSW	15	66758006	critical splice donor site	probably null
sariba	UTSW	15	66694870	missense	probably benign	0.01
ticker	UTSW	15	66827382	nonsense	probably null
Vampire	UTSW	15	66682827	missense	probably damaging	1.00
IGL03134:Tg	UTSW	15	66740718	missense	probably damaging	1.00
P0019:Tg	UTSW	15	66688863	missense	probably benign	0.01
R0121:Tg	UTSW	15	66740781	missense	probably benign	0.04
R0135:Tg	UTSW	15	66694870	missense	probably benign	0.01
R0227:Tg	UTSW	15	66698446	missense	possibly damaging	0.84
R0448:Tg	UTSW	15	66764442	missense	probably damaging	1.00
R0453:Tg	UTSW	15	66828533	missense	probably benign	0.09
R0504:Tg	UTSW	15	66682404	missense	probably damaging	0.97
R0543:Tg	UTSW	15	66729597	missense	probably benign	0.13
R0638:Tg	UTSW	15	66717208	missense	probably damaging	0.99
R0639:Tg	UTSW	15	66741484	critical splice acceptor site	probably null
R0646:Tg	UTSW	15	66729626	missense	probably damaging	0.99
R0666:Tg	UTSW	15	66737521	missense	probably benign
R0673:Tg	UTSW	15	66741484	critical splice acceptor site	probably null
R0689:Tg	UTSW	15	66839404	splice site	probably benign
R0704:Tg	UTSW	15	66757880	missense	probably benign	0.02
R0730:Tg	UTSW	15	66678789	missense	probably damaging	1.00
R0830:Tg	UTSW	15	66725144	missense	probably damaging	1.00
R0959:Tg	UTSW	15	66708010	missense	probably damaging	0.98
R1027:Tg	UTSW	15	66672409	missense	possibly damaging	0.65
R1061:Tg	UTSW	15	66698559	missense	probably benign	0.09
R1086:Tg	UTSW	15	66684062	missense	probably benign
R1103:Tg	UTSW	15	66719655	missense	probably benign	0.45
R1240:Tg	UTSW	15	66828548	missense	probably benign	0.16
R1281:Tg	UTSW	15	66696489	missense	probably benign	0.34
R1470:Tg	UTSW	15	66849463	missense	possibly damaging	0.95
R1470:Tg	UTSW	15	66849463	missense	possibly damaging	0.95
R1531:Tg	UTSW	15	66850502	missense	probably benign	0.02
R1544:Tg	UTSW	15	66705232	missense	probably benign	0.04
R1550:Tg	UTSW	15	66693430	missense	possibly damaging	0.52
R1575:Tg	UTSW	15	66729685	critical splice donor site	probably null
R1638:Tg	UTSW	15	66696166	nonsense	probably null
R1655:Tg	UTSW	15	66828568	critical splice donor site	probably null
R1671:Tg	UTSW	15	66692387	missense	possibly damaging	0.89
R1789:Tg	UTSW	15	66737548	missense	probably benign	0.00
R1883:Tg	UTSW	15	66671309	missense	probably damaging	1.00
R1984:Tg	UTSW	15	66682842	missense	probably benign
R2063:Tg	UTSW	15	66828553	missense	probably damaging	1.00
R2092:Tg	UTSW	15	66849607	missense	probably null	0.26
R2109:Tg	UTSW	15	66729594	missense	probably benign	0.02
R2128:Tg	UTSW	15	66694894	missense	probably benign	0.10
R2129:Tg	UTSW	15	66694894	missense	probably benign	0.10
R2207:Tg	UTSW	15	66681939	missense	probably benign	0.15
R2219:Tg	UTSW	15	66681933	missense	probably benign	0.03
R2228:Tg	UTSW	15	66674011	missense	probably damaging	0.99
R2229:Tg	UTSW	15	66674011	missense	probably damaging	0.99
R2259:Tg	UTSW	15	66683898	missense	probably benign
R2994:Tg	UTSW	15	66681953	missense	probably benign
R3904:Tg	UTSW	15	66766162	nonsense	probably null
R3946:Tg	UTSW	15	66674023	missense	probably damaging	1.00
R3965:Tg	UTSW	15	66684190	missense	probably benign
R4245:Tg	UTSW	15	66696469	missense	possibly damaging	0.68
R4451:Tg	UTSW	15	66766147	missense	probably benign	0.01
R4487:Tg	UTSW	15	66671396	missense	probably damaging	1.00
R4489:Tg	UTSW	15	66707942	missense	probably damaging	1.00
R4623:Tg	UTSW	15	66735271	missense	probably benign	0.23
R4659:Tg	UTSW	15	66673920	missense	possibly damaging	0.67
R4728:Tg	UTSW	15	66682827	missense	probably damaging	1.00
R4760:Tg	UTSW	15	66693319	missense	probably damaging	1.00
R4797:Tg	UTSW	15	66758006	critical splice donor site	probably null
R4944:Tg	UTSW	15	66764337	missense	probably damaging	1.00
R4998:Tg	UTSW	15	66674050	missense	probably damaging	1.00
R5009:Tg	UTSW	15	66696586	missense	probably benign	0.01
R5025:Tg	UTSW	15	66707930	missense	probably damaging	1.00
R5035:Tg	UTSW	15	66681813	splice site	probably null
R5049:Tg	UTSW	15	66827382	nonsense	probably null
R5073:Tg	UTSW	15	66735252	missense	probably benign	0.05
R5169:Tg	UTSW	15	66678780	nonsense	probably null
R5185:Tg	UTSW	15	66773474	missense	probably damaging	1.00
R5227:Tg	UTSW	15	66759567	missense	possibly damaging	0.87
R5300:Tg	UTSW	15	66678855	missense	probably damaging	1.00
R5334:Tg	UTSW	15	66678055	missense	probably damaging	1.00
R5339:Tg	UTSW	15	66678093	missense	probably damaging	1.00
R5402:Tg	UTSW	15	66739168	missense	probably damaging	0.98
R5441:Tg	UTSW	15	66696520	missense	possibly damaging	0.47
R5509:Tg	UTSW	15	66827293	missense	probably benign	0.45
R5582:Tg	UTSW	15	66693435	missense	probably damaging	1.00
R5624:Tg	UTSW	15	66838057	missense	probably benign	0.11
R5686:Tg	UTSW	15	66688889	missense	probably benign	0.28
R6042:Tg	UTSW	15	66683993	missense	probably benign	0.01
R6122:Tg	UTSW	15	66828457	missense	probably damaging	1.00
R6146:Tg	UTSW	15	66673367	splice site	probably null
R6159:Tg	UTSW	15	66735247	missense	possibly damaging	0.71
R6223:Tg	UTSW	15	66707922	missense	probably benign	0.15
R6480:Tg	UTSW	15	66671311	missense	probably damaging	1.00
R6505:Tg	UTSW	15	66759558	missense	probably damaging	0.99
R6531:Tg	UTSW	15	66839362	missense	probably damaging	0.99
R6614:Tg	UTSW	15	66735259	missense	probably damaging	0.99
R6698:Tg	UTSW	15	66839362	missense	probably damaging	1.00
R6798:Tg	UTSW	15	66678839	missense	probably damaging	1.00
R6837:Tg	UTSW	15	66696135	missense	probably damaging	1.00
R6861:Tg	UTSW	15	66688891	missense	probably benign	0.00
R6888:Tg	UTSW	15	66696246	missense	probably damaging	0.99
R6933:Tg	UTSW	15	66764309	missense	possibly damaging	0.73
R6983:Tg	UTSW	15	66693358	missense	probably benign	0.01
R7078:Tg	UTSW	15	66673543	missense	probably damaging	1.00
R7244:Tg	UTSW	15	66740714	missense	probably damaging	1.00
R7320:Tg	UTSW	15	66694784	missense	possibly damaging	0.71
R7334:Tg	UTSW	15	66725272	missense	probably benign	0.01
R7418:Tg	UTSW	15	66696583	missense	probably damaging	0.99
R7485:Tg	UTSW	15	66696588	missense	probably benign	0.04
R7524:Tg	UTSW	15	66696161	missense	probably benign	0.01
R7529:Tg	UTSW	15	66694768	missense	probably damaging	0.99
R7540:Tg	UTSW	15	66689927	missense	probably benign	0.16
R7583:Tg	UTSW	15	66764418	missense	probably damaging	1.00
R7594:Tg	UTSW	15	66729583	missense	probably benign	0.20
R7667:Tg	UTSW	15	66715163	missense	probably damaging	0.98
R7722:Tg	UTSW	15	66764309	missense	possibly damaging	0.73
R7790:Tg	UTSW	15	66849604	missense	probably damaging	0.99
R7838:Tg	UTSW	15	66693263	missense	probably benign	0.00
R7890:Tg	UTSW	15	66683814	missense	probably damaging	1.00
R7904:Tg	UTSW	15	66705279	missense	probably benign	0.08
R7919:Tg	UTSW	15	66684074	missense	possibly damaging	0.73
R7921:Tg	UTSW	15	66683793	missense	probably benign	0.08
R8037:Tg	UTSW	15	66688875	missense	probably benign	0.00
R8038:Tg	UTSW	15	66688875	missense	probably benign	0.00
R8214:Tg	UTSW	15	66773398	missense	probably damaging	1.00
R8304:Tg	UTSW	15	66693260	nonsense	probably null
R8688:Tg	UTSW	15	66694953	critical splice donor site	probably benign
R8709:Tg	UTSW	15	66681937	missense	probably benign	0.08
R8714:Tg	UTSW	15	66684042	missense	probably damaging	0.97
R8901:Tg	UTSW	15	66685335	missense	probably damaging	1.00
R8917:Tg	UTSW	15	66773483	critical splice donor site	probably null
R9023:Tg	UTSW	15	66683673	missense	probably damaging	1.00
R9232:Tg	UTSW	15	66698461	missense	probably benign	0.01
R9310:Tg	UTSW	15	66827269	missense	possibly damaging	0.69
R9361:Tg	UTSW	15	66685397	missense	possibly damaging	0.50
R9389:Tg	UTSW	15	66689324	missense	probably benign	0.04
R9501:Tg	UTSW	15	66847074	missense	possibly damaging	0.52
R9510:Tg	UTSW	15	66674064	missense	probably damaging	1.00
R9594:Tg	UTSW	15	66735260	nonsense	probably null
R9629:Tg	UTSW	15	66683738	missense	possibly damaging	0.95
R9701:Tg	UTSW	15	66766142	missense	probably benign	0.03
R9743:Tg	UTSW	15	66689990	missense	probably benign	0.18
R9748:Tg	UTSW	15	66847159	missense	possibly damaging	0.91
T0975:Tg	UTSW	15	66688863	missense	probably benign	0.01
X0005:Tg	UTSW	15	66688863	missense	probably benign	0.01
X0065:Tg	UTSW	15	66682454	missense	probably damaging	1.00
X0067:Tg	UTSW	15	66748743	missense	probably benign	0.10
Z1177:Tg	UTSW	15	66685310	missense	possibly damaging	0.49
Z1177:Tg	UTSW	15	66849547	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CTCAAACTGAGTCTGGCATGG -3'
(R):5'- AACACTCACTGGACTGAGCAG -3'

Sequencing Primer
(F):5'- GGTGTGAACATTGCATATAACCAGTC -3'
(R):5'- TCACTGGACTGAGCAGCCAAG -3'

Posted On

2016-10-26