Incidental Mutation 'R5580:Tg'
ID 438436
Institutional Source Beutler Lab
Gene Symbol Tg
Ensembl Gene ENSMUSG00000053469
Gene Name thyroglobulin
Synonyms Tgn
MMRRC Submission 043134-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R5580 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 66542606-66722570 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 66557149 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 937 (I937V)
Ref Sequence ENSEMBL: ENSMUSP00000070239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065916]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000065916
AA Change: I937V

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469
AA Change: I937V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TY 50 97 5.9e-16 SMART
TY 118 165 5.59e-17 SMART
Pfam:Thyroglobulin_1 174 252 4e-9 PFAM
TY 317 363 4.36e-19 SMART
low complexity region 495 504 N/A INTRINSIC
TY 617 662 3.58e-15 SMART
TY 684 730 1.47e-16 SMART
TY 880 926 1.51e-4 SMART
TY 1029 1078 1.21e-12 SMART
TY 1106 1150 7.56e-5 SMART
TY 1167 1215 7.26e-16 SMART
low complexity region 1244 1255 N/A INTRINSIC
Pfam:GCC2_GCC3 1464 1509 2.7e-16 PFAM
TY 1519 1568 9.81e-13 SMART
Pfam:COesterase 2181 2717 8.4e-140 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410002F23Rik A G 7: 43,900,664 (GRCm39) T73A possibly damaging Het
A1bg A T 15: 60,790,881 (GRCm39) V365E probably benign Het
Abcg5 A C 17: 84,967,582 (GRCm39) V406G probably damaging Het
Adamts12 A G 15: 11,152,086 (GRCm39) Y192C probably benign Het
Add3 C T 19: 53,233,642 (GRCm39) S649L probably damaging Het
Adgrg6 A T 10: 14,286,228 (GRCm39) C1129* probably null Het
Arsb T A 13: 93,944,053 (GRCm39) V248D probably damaging Het
AW554918 A T 18: 25,472,922 (GRCm39) N39I probably damaging Het
Cacna1b A T 2: 24,540,566 (GRCm39) I1383N probably damaging Het
Caprin2 A T 6: 148,760,232 (GRCm39) V625D possibly damaging Het
Cd9 A G 6: 125,441,420 (GRCm39) L67P probably damaging Het
Cdh5 T A 8: 104,852,126 (GRCm39) Y80* probably null Het
Csf2ra A G 19: 61,214,655 (GRCm39) L223P probably damaging Het
Cyp2c67 T C 19: 39,604,094 (GRCm39) K421E probably damaging Het
Dzank1 T C 2: 144,348,098 (GRCm39) R223G probably damaging Het
Emilin2 A G 17: 71,582,225 (GRCm39) V167A probably benign Het
Eps8l3 A G 3: 107,788,919 (GRCm39) T81A probably damaging Het
Esrra T C 19: 6,897,755 (GRCm39) M1V probably null Het
Evpl C A 11: 116,125,058 (GRCm39) A135S probably benign Het
Fam193a A G 5: 34,578,132 (GRCm39) I209V probably benign Het
Fbxl19 C A 7: 127,350,168 (GRCm39) C253* probably null Het
Fer1l5 T A 1: 36,424,539 (GRCm39) Y305* probably null Het
Fzd2 A C 11: 102,496,665 (GRCm39) I370L probably damaging Het
Gnl3 T C 14: 30,737,242 (GRCm39) K212R probably benign Het
Golm1 A G 13: 59,790,179 (GRCm39) L207P probably benign Het
Gphn T A 12: 78,538,818 (GRCm39) F155I probably damaging Het
Grhl1 G A 12: 24,659,739 (GRCm39) G500S probably benign Het
Gucd1 C A 10: 75,346,968 (GRCm39) G55V possibly damaging Het
Haus6 A T 4: 86,517,503 (GRCm39) I287K possibly damaging Het
Hmcn1 G A 1: 150,453,290 (GRCm39) P5342S probably benign Het
Hspa12a A G 19: 58,788,092 (GRCm39) S577P probably benign Het
Ido2 T A 8: 25,040,882 (GRCm39) I113F possibly damaging Het
Ifrd2 C T 9: 107,469,511 (GRCm39) P396S probably damaging Het
Igkv4-86 T A 6: 68,887,990 (GRCm39) probably benign Het
Ipo11 A G 13: 107,037,255 (GRCm39) V196A probably benign Het
Itih2 T C 2: 10,128,287 (GRCm39) E138G probably damaging Het
Kidins220 T G 12: 25,097,896 (GRCm39) C1179G probably benign Het
Kif20b T A 19: 34,927,128 (GRCm39) probably null Het
Klk1 T A 7: 43,878,238 (GRCm39) Y63N probably benign Het
L3mbtl3 T G 10: 26,179,604 (GRCm39) D517A unknown Het
Lars1 G T 18: 42,347,916 (GRCm39) P969H probably damaging Het
Lrp1 C T 10: 127,424,389 (GRCm39) V766I probably benign Het
Lrrc8c A G 5: 105,755,553 (GRCm39) I443V probably benign Het
Lsg1 T C 16: 30,387,985 (GRCm39) M439V probably null Het
Magi2 T A 5: 20,420,422 (GRCm39) M286K probably benign Het
Med11 T C 11: 70,342,891 (GRCm39) probably null Het
Med13l A G 5: 118,889,695 (GRCm39) K1819E possibly damaging Het
Ms4a14 T A 19: 11,280,590 (GRCm39) Q656L probably benign Het
Muc5b A G 7: 141,415,084 (GRCm39) T2677A possibly damaging Het
Myo7a A T 7: 97,722,367 (GRCm39) L1186H probably damaging Het
Naca C A 10: 127,876,462 (GRCm39) probably benign Het
Nbeal1 T C 1: 60,281,761 (GRCm39) I828T probably benign Het
Ncor1 A T 11: 62,280,604 (GRCm39) C75* probably null Het
Nepn A C 10: 52,280,398 (GRCm39) S497R probably damaging Het
Nf2 A G 11: 4,753,689 (GRCm39) F222L probably damaging Het
Nlrp9b A C 7: 19,757,089 (GRCm39) T109P probably damaging Het
Nr1h4 A T 10: 89,352,302 (GRCm39) F22I probably benign Het
Ogg1 A G 6: 113,306,337 (GRCm39) Y178C probably damaging Het
Or1e22 G T 11: 73,377,036 (GRCm39) P205T probably benign Het
Or4b12 C A 2: 90,096,694 (GRCm39) V27L probably benign Het
Or5b119 T A 19: 13,456,791 (GRCm39) Y257F probably damaging Het
Or5b21 G A 19: 12,839,168 (GRCm39) V10M possibly damaging Het
Or5d14 A T 2: 87,880,668 (GRCm39) M100K possibly damaging Het
Osr1 G A 12: 9,629,325 (GRCm39) R66Q probably damaging Het
Pi4ka A G 16: 17,098,951 (GRCm39) S1978P probably damaging Het
Pik3c2g A T 6: 139,603,531 (GRCm39) Q239L probably damaging Het
Pin1rt1 A G 2: 104,544,670 (GRCm39) I154T probably damaging Het
Pkdcc A G 17: 83,527,511 (GRCm39) T230A probably damaging Het
Por A T 5: 135,762,675 (GRCm39) I430F probably damaging Het
Prb1c T C 6: 132,338,432 (GRCm39) N262S unknown Het
Prkcsh T A 9: 21,922,551 (GRCm39) probably null Het
Pros1 A G 16: 62,746,689 (GRCm39) probably null Het
Pus10 T A 11: 23,622,556 (GRCm39) L59I probably benign Het
Pxmp2 A G 5: 110,431,542 (GRCm39) V67A possibly damaging Het
Rab3gap1 C A 1: 127,858,727 (GRCm39) A612E probably benign Het
Rpap2 A G 5: 107,768,011 (GRCm39) E206G probably benign Het
Rpl31 C T 1: 39,409,108 (GRCm39) R41C probably benign Het
Ryr3 C T 2: 112,672,293 (GRCm39) G1393R probably damaging Het
Scara5 T C 14: 65,968,528 (GRCm39) M267T probably benign Het
Sema5a A T 15: 32,575,031 (GRCm39) I380F probably benign Het
Slc36a3 A G 11: 55,026,279 (GRCm39) S180P probably benign Het
Slc44a5 A G 3: 153,966,922 (GRCm39) K536R probably benign Het
Smg1 T C 7: 117,748,125 (GRCm39) probably benign Het
Spata31d1e A T 13: 59,890,070 (GRCm39) D583E probably benign Het
Strc T C 2: 121,205,493 (GRCm39) K879R probably damaging Het
Swt1 T C 1: 151,260,206 (GRCm39) E731G probably benign Het
Syngap1 G A 17: 27,181,305 (GRCm39) A9T probably damaging Het
Tex15 C T 8: 34,062,457 (GRCm39) T903I probably damaging Het
Tm9sf4 T C 2: 153,024,350 (GRCm39) Y58H probably damaging Het
Tsen2 A T 6: 115,554,941 (GRCm39) D458V probably damaging Het
Ttn T A 2: 76,748,146 (GRCm39) D4301V probably benign Het
Txk C A 5: 72,864,932 (GRCm39) L314F probably damaging Het
Ube3b A G 5: 114,553,384 (GRCm39) T919A probably benign Het
Ubn2 A G 6: 38,460,187 (GRCm39) M641V probably damaging Het
Usp4 C T 9: 108,243,058 (GRCm39) T242I probably benign Het
Usp53 A G 3: 122,727,883 (GRCm39) S900P probably benign Het
Vmn1r225 T C 17: 20,723,101 (GRCm39) Y181H probably damaging Het
Vmn1r83 T A 7: 12,055,800 (GRCm39) I86L probably benign Het
Vmn2r65 T C 7: 84,596,802 (GRCm39) I84M probably damaging Het
Vstm2b A G 7: 40,552,050 (GRCm39) H126R probably damaging Het
Zfp524 A T 7: 5,021,416 (GRCm39) I315F probably benign Het
Zfp975 A T 7: 42,314,513 (GRCm39) L20* probably null Het
Other mutations in Tg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Tg APN 15 66,719,015 (GRCm39) missense probably damaging 1.00
IGL00230:Tg APN 15 66,699,139 (GRCm39) missense probably benign 0.00
IGL00324:Tg APN 15 66,565,273 (GRCm39) missense probably benign
IGL00428:Tg APN 15 66,645,273 (GRCm39) missense probably benign 0.33
IGL00703:Tg APN 15 66,568,338 (GRCm39) missense probably benign 0.34
IGL00808:Tg APN 15 66,555,662 (GRCm39) missense probably damaging 1.00
IGL00833:Tg APN 15 66,560,650 (GRCm39) missense probably benign 0.34
IGL00899:Tg APN 15 66,545,922 (GRCm39) critical splice donor site probably null
IGL00921:Tg APN 15 66,636,302 (GRCm39) missense probably benign 0.28
IGL00975:Tg APN 15 66,553,731 (GRCm39) missense probably benign
IGL01288:Tg APN 15 66,608,125 (GRCm39) missense possibly damaging 0.81
IGL01397:Tg APN 15 66,567,941 (GRCm39) splice site probably benign
IGL01634:Tg APN 15 66,601,415 (GRCm39) missense probably benign 0.34
IGL01646:Tg APN 15 66,549,936 (GRCm39) missense probably damaging 1.00
IGL01704:Tg APN 15 66,543,200 (GRCm39) missense probably damaging 0.98
IGL01958:Tg APN 15 66,631,335 (GRCm39) missense probably benign 0.06
IGL02093:Tg APN 15 66,564,223 (GRCm39) missense possibly damaging 0.83
IGL02113:Tg APN 15 66,577,179 (GRCm39) missense probably benign 0.08
IGL02138:Tg APN 15 66,589,082 (GRCm39) missense probably benign 0.01
IGL02156:Tg APN 15 66,577,197 (GRCm39) missense probably benign 0.19
IGL02169:Tg APN 15 66,629,792 (GRCm39) missense probably benign 0.04
IGL02342:Tg APN 15 66,636,140 (GRCm39) missense probably benign
IGL02434:Tg APN 15 66,636,191 (GRCm39) missense probably damaging 0.97
IGL02506:Tg APN 15 66,613,443 (GRCm39) missense possibly damaging 0.71
IGL02513:Tg APN 15 66,577,123 (GRCm39) missense probably benign
IGL02549:Tg APN 15 66,711,210 (GRCm39) missense probably damaging 1.00
IGL02669:Tg APN 15 66,620,575 (GRCm39) splice site probably benign
IGL02756:Tg APN 15 66,606,435 (GRCm39) missense probably benign
IGL02800:Tg APN 15 66,629,735 (GRCm39) missense probably damaging 1.00
IGL02828:Tg APN 15 66,554,243 (GRCm39) missense probably damaging 1.00
IGL02927:Tg APN 15 66,549,942 (GRCm39) missense probably damaging 1.00
IGL03061:Tg APN 15 66,543,254 (GRCm39) missense probably damaging 1.00
IGL03105:Tg APN 15 66,586,955 (GRCm39) missense probably benign 0.01
IGL03160:Tg APN 15 66,711,152 (GRCm39) nonsense probably null
IGL03242:Tg APN 15 66,555,647 (GRCm39) missense probably damaging 0.99
Also_ran UTSW 15 66,550,688 (GRCm39) missense probably damaging 1.00
bedraggled UTSW 15 66,612,563 (GRCm39) missense probably damaging 1.00
foster UTSW 15 66,565,109 (GRCm39) nonsense probably null
hognose UTSW 15 66,589,057 (GRCm39) missense probably damaging 0.99
ito UTSW 15 66,638,011 (GRCm39) nonsense probably null
ito2 UTSW 15 66,543,245 (GRCm39) missense probably damaging 1.00
ito3 UTSW 15 66,645,323 (GRCm39) missense probably damaging 1.00
ito4 UTSW 15 66,568,369 (GRCm39) missense possibly damaging 0.47
Papua UTSW 15 66,545,899 (GRCm39) missense probably damaging 1.00
Pipistrella UTSW 15 66,567,984 (GRCm39) missense probably damaging 1.00
pluribus UTSW 15 66,587,012 (GRCm39) missense probably damaging 0.98
samarai UTSW 15 66,629,855 (GRCm39) critical splice donor site probably null
sariba UTSW 15 66,566,719 (GRCm39) missense probably benign 0.01
ticker UTSW 15 66,699,231 (GRCm39) nonsense probably null
Vampire UTSW 15 66,554,676 (GRCm39) missense probably damaging 1.00
IGL03134:Tg UTSW 15 66,612,567 (GRCm39) missense probably damaging 1.00
P0019:Tg UTSW 15 66,560,712 (GRCm39) missense probably benign 0.01
R0121:Tg UTSW 15 66,612,630 (GRCm39) missense probably benign 0.04
R0135:Tg UTSW 15 66,566,719 (GRCm39) missense probably benign 0.01
R0227:Tg UTSW 15 66,570,295 (GRCm39) missense possibly damaging 0.84
R0448:Tg UTSW 15 66,636,291 (GRCm39) missense probably damaging 1.00
R0453:Tg UTSW 15 66,700,382 (GRCm39) missense probably benign 0.09
R0504:Tg UTSW 15 66,554,253 (GRCm39) missense probably damaging 0.97
R0543:Tg UTSW 15 66,601,446 (GRCm39) missense probably benign 0.13
R0638:Tg UTSW 15 66,589,057 (GRCm39) missense probably damaging 0.99
R0639:Tg UTSW 15 66,613,333 (GRCm39) critical splice acceptor site probably null
R0646:Tg UTSW 15 66,601,475 (GRCm39) missense probably damaging 0.99
R0666:Tg UTSW 15 66,609,370 (GRCm39) missense probably benign
R0673:Tg UTSW 15 66,613,333 (GRCm39) critical splice acceptor site probably null
R0689:Tg UTSW 15 66,711,253 (GRCm39) splice site probably benign
R0704:Tg UTSW 15 66,629,729 (GRCm39) missense probably benign 0.02
R0730:Tg UTSW 15 66,550,638 (GRCm39) missense probably damaging 1.00
R0830:Tg UTSW 15 66,596,993 (GRCm39) missense probably damaging 1.00
R0959:Tg UTSW 15 66,579,859 (GRCm39) missense probably damaging 0.98
R1027:Tg UTSW 15 66,544,258 (GRCm39) missense possibly damaging 0.65
R1061:Tg UTSW 15 66,570,408 (GRCm39) missense probably benign 0.09
R1086:Tg UTSW 15 66,555,911 (GRCm39) missense probably benign
R1103:Tg UTSW 15 66,591,504 (GRCm39) missense probably benign 0.45
R1240:Tg UTSW 15 66,700,397 (GRCm39) missense probably benign 0.16
R1281:Tg UTSW 15 66,568,338 (GRCm39) missense probably benign 0.34
R1470:Tg UTSW 15 66,721,312 (GRCm39) missense possibly damaging 0.95
R1470:Tg UTSW 15 66,721,312 (GRCm39) missense possibly damaging 0.95
R1531:Tg UTSW 15 66,722,351 (GRCm39) missense probably benign 0.02
R1544:Tg UTSW 15 66,577,081 (GRCm39) missense probably benign 0.04
R1550:Tg UTSW 15 66,565,279 (GRCm39) missense possibly damaging 0.52
R1575:Tg UTSW 15 66,601,534 (GRCm39) critical splice donor site probably null
R1638:Tg UTSW 15 66,568,015 (GRCm39) nonsense probably null
R1655:Tg UTSW 15 66,700,417 (GRCm39) critical splice donor site probably null
R1671:Tg UTSW 15 66,564,236 (GRCm39) missense possibly damaging 0.89
R1789:Tg UTSW 15 66,609,397 (GRCm39) missense probably benign 0.00
R1883:Tg UTSW 15 66,543,158 (GRCm39) missense probably damaging 1.00
R1984:Tg UTSW 15 66,554,691 (GRCm39) missense probably benign
R2063:Tg UTSW 15 66,700,402 (GRCm39) missense probably damaging 1.00
R2092:Tg UTSW 15 66,721,456 (GRCm39) missense probably null 0.26
R2109:Tg UTSW 15 66,601,443 (GRCm39) missense probably benign 0.02
R2128:Tg UTSW 15 66,566,743 (GRCm39) missense probably benign 0.10
R2129:Tg UTSW 15 66,566,743 (GRCm39) missense probably benign 0.10
R2207:Tg UTSW 15 66,553,788 (GRCm39) missense probably benign 0.15
R2219:Tg UTSW 15 66,553,782 (GRCm39) missense probably benign 0.03
R2228:Tg UTSW 15 66,545,860 (GRCm39) missense probably damaging 0.99
R2229:Tg UTSW 15 66,545,860 (GRCm39) missense probably damaging 0.99
R2259:Tg UTSW 15 66,555,747 (GRCm39) missense probably benign
R2994:Tg UTSW 15 66,553,802 (GRCm39) missense probably benign
R3904:Tg UTSW 15 66,638,011 (GRCm39) nonsense probably null
R3946:Tg UTSW 15 66,545,872 (GRCm39) missense probably damaging 1.00
R3965:Tg UTSW 15 66,556,039 (GRCm39) missense probably benign
R4245:Tg UTSW 15 66,568,318 (GRCm39) missense possibly damaging 0.68
R4451:Tg UTSW 15 66,637,996 (GRCm39) missense probably benign 0.01
R4487:Tg UTSW 15 66,543,245 (GRCm39) missense probably damaging 1.00
R4489:Tg UTSW 15 66,579,791 (GRCm39) missense probably damaging 1.00
R4623:Tg UTSW 15 66,607,120 (GRCm39) missense probably benign 0.23
R4659:Tg UTSW 15 66,545,769 (GRCm39) missense possibly damaging 0.67
R4728:Tg UTSW 15 66,554,676 (GRCm39) missense probably damaging 1.00
R4760:Tg UTSW 15 66,565,168 (GRCm39) missense probably damaging 1.00
R4797:Tg UTSW 15 66,629,855 (GRCm39) critical splice donor site probably null
R4944:Tg UTSW 15 66,636,186 (GRCm39) missense probably damaging 1.00
R4998:Tg UTSW 15 66,545,899 (GRCm39) missense probably damaging 1.00
R5009:Tg UTSW 15 66,568,435 (GRCm39) missense probably benign 0.01
R5025:Tg UTSW 15 66,579,779 (GRCm39) missense probably damaging 1.00
R5035:Tg UTSW 15 66,553,662 (GRCm39) splice site probably null
R5049:Tg UTSW 15 66,699,231 (GRCm39) nonsense probably null
R5073:Tg UTSW 15 66,607,101 (GRCm39) missense probably benign 0.05
R5169:Tg UTSW 15 66,550,629 (GRCm39) nonsense probably null
R5185:Tg UTSW 15 66,645,323 (GRCm39) missense probably damaging 1.00
R5227:Tg UTSW 15 66,631,416 (GRCm39) missense possibly damaging 0.87
R5300:Tg UTSW 15 66,550,704 (GRCm39) missense probably damaging 1.00
R5334:Tg UTSW 15 66,549,904 (GRCm39) missense probably damaging 1.00
R5339:Tg UTSW 15 66,549,942 (GRCm39) missense probably damaging 1.00
R5402:Tg UTSW 15 66,611,017 (GRCm39) missense probably damaging 0.98
R5441:Tg UTSW 15 66,568,369 (GRCm39) missense possibly damaging 0.47
R5509:Tg UTSW 15 66,699,142 (GRCm39) missense probably benign 0.45
R5582:Tg UTSW 15 66,565,284 (GRCm39) missense probably damaging 1.00
R5624:Tg UTSW 15 66,709,906 (GRCm39) missense probably benign 0.11
R5686:Tg UTSW 15 66,560,738 (GRCm39) missense probably benign 0.28
R6042:Tg UTSW 15 66,555,842 (GRCm39) missense probably benign 0.01
R6122:Tg UTSW 15 66,700,306 (GRCm39) missense probably damaging 1.00
R6146:Tg UTSW 15 66,545,216 (GRCm39) splice site probably null
R6159:Tg UTSW 15 66,607,096 (GRCm39) missense possibly damaging 0.71
R6223:Tg UTSW 15 66,579,771 (GRCm39) missense probably benign 0.15
R6480:Tg UTSW 15 66,543,160 (GRCm39) missense probably damaging 1.00
R6505:Tg UTSW 15 66,631,407 (GRCm39) missense probably damaging 0.99
R6531:Tg UTSW 15 66,711,211 (GRCm39) missense probably damaging 0.99
R6614:Tg UTSW 15 66,607,108 (GRCm39) missense probably damaging 0.99
R6698:Tg UTSW 15 66,711,211 (GRCm39) missense probably damaging 1.00
R6798:Tg UTSW 15 66,550,688 (GRCm39) missense probably damaging 1.00
R6837:Tg UTSW 15 66,567,984 (GRCm39) missense probably damaging 1.00
R6861:Tg UTSW 15 66,560,740 (GRCm39) missense probably benign 0.00
R6888:Tg UTSW 15 66,568,095 (GRCm39) missense probably damaging 0.99
R6933:Tg UTSW 15 66,636,158 (GRCm39) missense possibly damaging 0.73
R6983:Tg UTSW 15 66,565,207 (GRCm39) missense probably benign 0.01
R7078:Tg UTSW 15 66,545,392 (GRCm39) missense probably damaging 1.00
R7244:Tg UTSW 15 66,612,563 (GRCm39) missense probably damaging 1.00
R7320:Tg UTSW 15 66,566,633 (GRCm39) missense possibly damaging 0.71
R7334:Tg UTSW 15 66,597,121 (GRCm39) missense probably benign 0.01
R7418:Tg UTSW 15 66,568,432 (GRCm39) missense probably damaging 0.99
R7485:Tg UTSW 15 66,568,437 (GRCm39) missense probably benign 0.04
R7524:Tg UTSW 15 66,568,010 (GRCm39) missense probably benign 0.01
R7529:Tg UTSW 15 66,566,617 (GRCm39) missense probably damaging 0.99
R7540:Tg UTSW 15 66,561,776 (GRCm39) missense probably benign 0.16
R7583:Tg UTSW 15 66,636,267 (GRCm39) missense probably damaging 1.00
R7594:Tg UTSW 15 66,601,432 (GRCm39) missense probably benign 0.20
R7667:Tg UTSW 15 66,587,012 (GRCm39) missense probably damaging 0.98
R7722:Tg UTSW 15 66,636,158 (GRCm39) missense possibly damaging 0.73
R7790:Tg UTSW 15 66,721,453 (GRCm39) missense probably damaging 0.99
R7838:Tg UTSW 15 66,565,112 (GRCm39) missense probably benign 0.00
R7890:Tg UTSW 15 66,555,663 (GRCm39) missense probably damaging 1.00
R7904:Tg UTSW 15 66,577,128 (GRCm39) missense probably benign 0.08
R7919:Tg UTSW 15 66,555,923 (GRCm39) missense possibly damaging 0.73
R7921:Tg UTSW 15 66,555,642 (GRCm39) missense probably benign 0.08
R8037:Tg UTSW 15 66,560,724 (GRCm39) missense probably benign 0.00
R8038:Tg UTSW 15 66,560,724 (GRCm39) missense probably benign 0.00
R8214:Tg UTSW 15 66,645,247 (GRCm39) missense probably damaging 1.00
R8304:Tg UTSW 15 66,565,109 (GRCm39) nonsense probably null
R8688:Tg UTSW 15 66,566,802 (GRCm39) critical splice donor site probably benign
R8709:Tg UTSW 15 66,553,786 (GRCm39) missense probably benign 0.08
R8714:Tg UTSW 15 66,555,891 (GRCm39) missense probably damaging 0.97
R8901:Tg UTSW 15 66,557,184 (GRCm39) missense probably damaging 1.00
R8917:Tg UTSW 15 66,645,332 (GRCm39) critical splice donor site probably null
R9023:Tg UTSW 15 66,555,522 (GRCm39) missense probably damaging 1.00
R9232:Tg UTSW 15 66,570,310 (GRCm39) missense probably benign 0.01
R9310:Tg UTSW 15 66,699,118 (GRCm39) missense possibly damaging 0.69
R9361:Tg UTSW 15 66,557,246 (GRCm39) missense possibly damaging 0.50
R9389:Tg UTSW 15 66,561,173 (GRCm39) missense probably benign 0.04
R9501:Tg UTSW 15 66,718,923 (GRCm39) missense possibly damaging 0.52
R9510:Tg UTSW 15 66,545,913 (GRCm39) missense probably damaging 1.00
R9594:Tg UTSW 15 66,607,109 (GRCm39) nonsense probably null
R9629:Tg UTSW 15 66,555,587 (GRCm39) missense possibly damaging 0.95
R9701:Tg UTSW 15 66,637,991 (GRCm39) missense probably benign 0.03
R9743:Tg UTSW 15 66,561,839 (GRCm39) missense probably benign 0.18
R9748:Tg UTSW 15 66,719,008 (GRCm39) missense possibly damaging 0.91
T0975:Tg UTSW 15 66,560,712 (GRCm39) missense probably benign 0.01
X0005:Tg UTSW 15 66,560,712 (GRCm39) missense probably benign 0.01
X0065:Tg UTSW 15 66,554,303 (GRCm39) missense probably damaging 1.00
X0067:Tg UTSW 15 66,620,592 (GRCm39) missense probably benign 0.10
Z1177:Tg UTSW 15 66,721,396 (GRCm39) missense probably benign 0.02
Z1177:Tg UTSW 15 66,557,159 (GRCm39) missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CTCAAACTGAGTCTGGCATGG -3'
(R):5'- AACACTCACTGGACTGAGCAG -3'

Sequencing Primer
(F):5'- GGTGTGAACATTGCATATAACCAGTC -3'
(R):5'- TCACTGGACTGAGCAGCCAAG -3'
Posted On 2016-10-26