Incidental Mutation 'R0071:Acrbp'
ID43845
Institutional Source Beutler Lab
Gene Symbol Acrbp
Ensembl Gene ENSMUSG00000072770
Gene Nameproacrosin binding protein
Synonymssp32, OY-TES-1
MMRRC Submission 038362-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R0071 (G1)
Quality Score213
Status Validated
Chromosome6
Chromosomal Location125049689-125063267 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 125050952 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032480] [ENSMUST00000032481] [ENSMUST00000088294] [ENSMUST00000112413] [ENSMUST00000112414] [ENSMUST00000112417] [ENSMUST00000140131]
Predicted Effect probably benign
Transcript: ENSMUST00000032480
SMART Domains Protein: ENSMUSP00000032480
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 5.5e-35 PFAM
low complexity region 118 131 N/A INTRINSIC
PHD 197 242 3.67e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000032481
SMART Domains Protein: ENSMUSP00000032481
Gene: ENSMUSG00000072770

DomainStartEndE-ValueType
Pfam:PBP_sp32 1 140 4.8e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088294
SMART Domains Protein: ENSMUSP00000085632
Gene: ENSMUSG00000072770

DomainStartEndE-ValueType
Pfam:PBP_sp32 1 239 1.6e-139 PFAM
KAZAL 466 506 1.42e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112412
SMART Domains Protein: ENSMUSP00000108031
Gene: ENSMUSG00000072770

DomainStartEndE-ValueType
Pfam:PBP_sp32 1 87 6.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112413
SMART Domains Protein: ENSMUSP00000108032
Gene: ENSMUSG00000072770

DomainStartEndE-ValueType
Pfam:PBP_sp32 1 169 6.2e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112414
SMART Domains Protein: ENSMUSP00000108033
Gene: ENSMUSG00000072770

DomainStartEndE-ValueType
Pfam:PBP_sp32 1 239 1.9e-138 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112417
SMART Domains Protein: ENSMUSP00000108036
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 6.5e-35 PFAM
low complexity region 118 126 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133695
Predicted Effect probably benign
Transcript: ENSMUST00000140131
SMART Domains Protein: ENSMUSP00000121519
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 6 107 2.1e-35 PFAM
low complexity region 114 139 N/A INTRINSIC
PHD 198 243 3.67e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140883
SMART Domains Protein: ENSMUSP00000118561
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 1e-34 PFAM
low complexity region 118 131 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151125
SMART Domains Protein: ENSMUSP00000119709
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 1.4e-34 PFAM
low complexity region 118 131 N/A INTRINSIC
PDB:1WEU|A 167 216 3e-32 PDB
SCOP:d1fp0a1 190 216 2e-3 SMART
Blast:PHD 197 215 1e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205110
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.2%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to proacrosin binding protein sp32 precursor found in mouse, guinea pig, and pig. This protein is located in the sperm acrosome and is thought to function as a binding protein to proacrosin for packaging and condensation of the acrosin zymogen in the acrosomal matrix. This protein is a member of the cancer/testis family of antigens and it is found to be immunogenic. In normal tissues, this mRNA is expressed only in testis, whereas it is detected in a range of different tumor types such as bladder, breast, lung, liver, and colon. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in delayed fertilization due to a delay in sperm penetration of the zona pellucida. Homozygous sperm also show reduced fertilization rates of oocytes with a thick or hardened zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik A G 16: 14,088,954 D11G probably damaging Het
4930474N05Rik A G 14: 36,090,789 probably benign Het
Acot12 T C 13: 91,781,174 probably benign Het
AI481877 A G 4: 59,059,643 Y1006H possibly damaging Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Aox3 T A 1: 58,171,891 C931* probably null Het
Apob T A 12: 8,002,111 V1184E probably damaging Het
Arhgap44 A T 11: 65,011,895 L582Q possibly damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Bccip A G 7: 133,714,231 D72G probably damaging Het
Bckdha A T 7: 25,630,443 probably null Het
Cald1 C T 6: 34,758,134 probably benign Het
Cdk11b T C 4: 155,649,423 probably benign Het
Cebpe G T 14: 54,710,604 R261S probably damaging Het
Cep95 C T 11: 106,790,728 probably benign Het
Chil1 T C 1: 134,185,279 Y150H probably benign Het
Chrnd T C 1: 87,192,837 probably benign Het
Clec4g T A 8: 3,717,489 probably benign Het
Cog2 T C 8: 124,548,668 probably benign Het
Coro7 A T 16: 4,670,527 L93Q probably damaging Het
Csmd3 T C 15: 47,596,821 T3525A probably benign Het
Ctsc G A 7: 88,308,149 probably benign Het
Dnajc16 T C 4: 141,768,007 T467A probably benign Het
Dnmt1 G A 9: 20,908,620 T1409I probably damaging Het
Fam227b T A 2: 126,124,074 N144Y probably benign Het
Fam83h A G 15: 76,002,528 S987P probably benign Het
Fhod1 A T 8: 105,337,225 probably null Het
Folr1 A G 7: 101,863,923 probably null Het
Glis3 C T 19: 28,263,855 probably benign Het
Gm10069 T C 6: 128,472,725 noncoding transcript Het
Golgb1 G A 16: 36,915,503 R1704Q probably benign Het
Gpr158 C A 2: 21,810,668 T624K probably benign Het
Helz2 T C 2: 181,236,407 Y866C probably damaging Het
Itpkb T A 1: 180,332,765 V152E probably damaging Het
Kcnma1 C T 14: 23,526,767 R236H probably damaging Het
Klhl32 A G 4: 24,743,907 V88A probably damaging Het
Lct C T 1: 128,292,018 W1631* probably null Het
Lipa T A 19: 34,495,082 K313M probably damaging Het
Ly75 T C 2: 60,321,819 K1130R probably benign Het
Mamdc2 C A 19: 23,303,630 E685* probably null Het
Mdm1 A G 10: 118,146,796 E112G probably damaging Het
Metrnl A T 11: 121,716,000 M212L probably benign Het
Mettl2 A G 11: 105,131,642 probably benign Het
Mxd3 A T 13: 55,329,636 L11Q probably damaging Het
Myo7a A T 7: 98,056,830 Y1836N probably damaging Het
Nsun7 A G 5: 66,264,045 Y118C probably benign Het
Obscn G A 11: 59,064,201 T3962M possibly damaging Het
Olfr195 C A 16: 59,149,215 R122S probably benign Het
Olfr53 A T 7: 140,652,257 I93F probably benign Het
Olfr716 A G 7: 107,147,712 Y132C probably damaging Het
Osbpl11 T C 16: 33,214,338 probably benign Het
Pcdhb22 A T 18: 37,520,078 D276V probably damaging Het
Pik3cb A T 9: 99,044,865 D886E probably benign Het
Pkhd1 T A 1: 20,201,344 Y2995F probably benign Het
Raver2 C T 4: 101,120,445 probably benign Het
Rhbdf1 A G 11: 32,210,498 L684P probably damaging Het
Rufy2 C A 10: 62,989,167 L75M possibly damaging Het
Sec22c A G 9: 121,692,913 F44L probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpina1a T C 12: 103,855,743 K310R probably benign Het
Sobp A G 10: 43,157,997 L111P probably damaging Het
Sparcl1 G T 5: 104,085,841 Y547* probably null Het
Spata31d1b G A 13: 59,715,349 A104T probably benign Het
Spert A G 14: 75,584,181 S44P probably benign Het
Spsb3 A G 17: 24,887,904 D184G probably damaging Het
Sptan1 A T 2: 30,003,342 K1148* probably null Het
Tdrd12 A G 7: 35,529,246 V17A possibly damaging Het
Tlr9 A G 9: 106,223,578 T23A probably benign Het
Tra2b A T 16: 22,254,401 probably benign Het
Tspan15 A G 10: 62,203,070 probably benign Het
Ttc41 A G 10: 86,736,846 N694S probably benign Het
Ttn T G 2: 76,767,469 D19700A probably damaging Het
Ube3b G A 5: 114,419,497 G1014D probably damaging Het
Unc5d A G 8: 28,719,826 V422A possibly damaging Het
Vmn2r80 C T 10: 79,171,732 T514I possibly damaging Het
Zfp595 T C 13: 67,316,853 K452E possibly damaging Het
Zfp607a A G 7: 27,878,269 K255E probably damaging Het
Zxdc T G 6: 90,370,416 V253G probably damaging Het
Other mutations in Acrbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Acrbp APN 6 125050514 missense probably damaging 1.00
IGL01656:Acrbp APN 6 125053712 missense possibly damaging 0.88
IGL02095:Acrbp APN 6 125053956 nonsense probably null
IGL02186:Acrbp APN 6 125054810 splice site probably null
IGL02473:Acrbp APN 6 125054698 missense probably benign
IGL02831:Acrbp APN 6 125061249 missense possibly damaging 0.89
IGL03110:Acrbp APN 6 125062473 missense probably damaging 0.99
R0071:Acrbp UTSW 6 125050952 unclassified probably benign
R0279:Acrbp UTSW 6 125053954 critical splice donor site probably null
R0483:Acrbp UTSW 6 125054796 missense possibly damaging 0.61
R1017:Acrbp UTSW 6 125061260 splice site probably benign
R1486:Acrbp UTSW 6 125050622 missense probably damaging 1.00
R4679:Acrbp UTSW 6 125060918 missense probably damaging 0.96
R4898:Acrbp UTSW 6 125050538 missense probably damaging 0.97
R4987:Acrbp UTSW 6 125053762 missense probably benign 0.23
R5249:Acrbp UTSW 6 125060922 missense probably damaging 0.98
R5458:Acrbp UTSW 6 125050050 unclassified probably benign
R5579:Acrbp UTSW 6 125061099 missense probably benign 0.00
R6491:Acrbp UTSW 6 125051479 unclassified probably benign
R7643:Acrbp UTSW 6 125053832 missense possibly damaging 0.92
R8217:Acrbp UTSW 6 125060958 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGAGTATGAACGCTTCTTCGCCC -3'
(R):5'- TGGAACGCCTTTCCCCATAAGCAG -3'

Sequencing Primer
(F):5'- GGCAAAAGCTTCGTGCTC -3'
(R):5'- GGGCATAATGACTCTGCCTTTTC -3'
Posted On2013-05-29