Incidental Mutation 'R5581:Chfr'
ID 438461
Institutional Source Beutler Lab
Gene Symbol Chfr
Ensembl Gene ENSMUSG00000014668
Gene Name checkpoint with forkhead and ring finger domains
Synonyms RNF116, 5730484M20Rik
MMRRC Submission 043135-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock # R5581 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 110135842-110171972 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 110153282 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014812] [ENSMUST00000014812] [ENSMUST00000112519] [ENSMUST00000198066] [ENSMUST00000198633] [ENSMUST00000198633] [ENSMUST00000199557] [ENSMUST00000199672]
AlphaFold Q810L3
Predicted Effect probably null
Transcript: ENSMUST00000014812
SMART Domains Protein: ENSMUSP00000014812
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 512 3.53e0 SMART
Blast:VWA 593 655 3e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000014812
SMART Domains Protein: ENSMUSP00000014812
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 512 3.53e0 SMART
Blast:VWA 593 655 3e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000112519
SMART Domains Protein: ENSMUSP00000108138
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 513 3.63e0 SMART
Blast:VWA 594 656 3e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197968
Predicted Effect probably benign
Transcript: ENSMUST00000198066
Predicted Effect probably null
Transcript: ENSMUST00000198633
SMART Domains Protein: ENSMUSP00000143480
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
RING 231 269 2.63e-4 SMART
low complexity region 324 349 N/A INTRINSIC
RING 371 441 3.63e0 SMART
Blast:VWA 522 584 2e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000198633
SMART Domains Protein: ENSMUSP00000143480
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
RING 231 269 2.63e-4 SMART
low complexity region 324 349 N/A INTRINSIC
RING 371 441 3.63e0 SMART
Blast:VWA 522 584 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199557
SMART Domains Protein: ENSMUSP00000143113
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
SCOP:d1lgpa_ 14 44 4e-5 SMART
PDB:1LGQ|B 16 44 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000199672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200403
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase required for the maintenance of the antephase checkpoint that regulates cell cycle entry into mitosis and, therefore, may play a key role in cell cycle progression and tumorigenesis. The encoded protein has an N-terminal forkhead-associated domain, a central RING-finger domain, and a cysteine-rich C-terminal region. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice and MEFs display increased tumor incidence and inducibility, premature death, increased chromosomal instability, and cell cycle abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik T C 15: 81,980,836 S93P probably damaging Het
Appbp2 G C 11: 85,210,095 R173G possibly damaging Het
Bcl11a A G 11: 24,163,932 K425R probably damaging Het
Casr A G 16: 36,494,744 M911T probably benign Het
Cdon C T 9: 35,504,081 A1205V probably benign Het
Dixdc1 A G 9: 50,669,480 L638P probably damaging Het
Filip1 C T 9: 79,819,760 V526M possibly damaging Het
Fsip2 T A 2: 82,998,128 D6756E possibly damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Lvrn A G 18: 46,890,865 T760A probably benign Het
Myh7 T A 14: 54,978,954 M1256L probably benign Het
Olfr146 T A 9: 39,018,702 I280F probably damaging Het
Pdia5 T C 16: 35,449,442 R166G probably benign Het
Plcz1 A G 6: 140,023,125 Y196H probably damaging Het
Ptpn12 T A 5: 21,015,726 E135D probably damaging Het
Rnh1 T C 7: 141,163,381 D191G probably benign Het
Slit1 A G 19: 41,616,663 probably null Het
Syne2 T G 12: 75,945,085 D1941E probably benign Het
Thsd4 C A 9: 59,972,458 A639S possibly damaging Het
Other mutations in Chfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Chfr APN 5 110143573 missense possibly damaging 0.94
IGL01479:Chfr APN 5 110144993 unclassified probably benign
IGL02543:Chfr APN 5 110143547 splice site probably null
IGL02657:Chfr APN 5 110154839 missense probably damaging 1.00
IGL03057:Chfr APN 5 110143609 missense probably benign 0.14
PIT4445001:Chfr UTSW 5 110151677 missense possibly damaging 0.88
R0938:Chfr UTSW 5 110164058 missense probably damaging 1.00
R1346:Chfr UTSW 5 110140447 missense probably damaging 1.00
R1561:Chfr UTSW 5 110158808 missense probably benign 0.05
R1602:Chfr UTSW 5 110151665 missense probably benign 0.26
R1658:Chfr UTSW 5 110153169 missense probably damaging 1.00
R2134:Chfr UTSW 5 110144761 splice site probably null
R2234:Chfr UTSW 5 110170863 missense probably damaging 1.00
R4371:Chfr UTSW 5 110136168 missense probably damaging 0.99
R4420:Chfr UTSW 5 110170880 nonsense probably null
R4666:Chfr UTSW 5 110144867 nonsense probably null
R4742:Chfr UTSW 5 110143598 missense probably benign 0.04
R4809:Chfr UTSW 5 110158834 missense probably damaging 1.00
R5490:Chfr UTSW 5 110153129 missense possibly damaging 0.88
R5820:Chfr UTSW 5 110162739 missense possibly damaging 0.94
R6012:Chfr UTSW 5 110144651 critical splice donor site probably null
R7128:Chfr UTSW 5 110143636 missense probably benign 0.33
R7166:Chfr UTSW 5 110158805 missense probably benign
R7278:Chfr UTSW 5 110140360 missense probably benign 0.23
R7393:Chfr UTSW 5 110152358 missense probably damaging 0.98
R7422:Chfr UTSW 5 110162705 splice site probably null
R7499:Chfr UTSW 5 110151683 missense probably benign 0.40
R8224:Chfr UTSW 5 110160243 critical splice donor site probably null
R8264:Chfr UTSW 5 110152434 missense possibly damaging 0.86
R8325:Chfr UTSW 5 110162763 nonsense probably null
R8333:Chfr UTSW 5 110154937 missense probably benign 0.05
R8823:Chfr UTSW 5 110152392 missense probably damaging 0.96
R9024:Chfr UTSW 5 110158832 missense probably benign 0.26
R9419:Chfr UTSW 5 110169190 missense probably damaging 1.00
X0013:Chfr UTSW 5 110151579 missense probably benign 0.19
Z1176:Chfr UTSW 5 110144895 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGTCCTTTGCCAGTGACTG -3'
(R):5'- GGTTCTTAACGGTGTTCACTGC -3'

Sequencing Primer
(F):5'- AGTGACTGCTGCTATGCC -3'
(R):5'- AACGGTGTTCACTGCTGCTC -3'
Posted On 2016-10-26