Incidental Mutation 'R5581:1700029P11Rik'
ID438475
Institutional Source Beutler Lab
Gene Symbol 1700029P11Rik
Ensembl Gene ENSMUSG00000061633
Gene NameRIKEN cDNA 1700029P11 gene
Synonyms
MMRRC Submission 043135-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.345) question?
Stock #R5581 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location81980540-81981563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81980836 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 93 (S93P)
Ref Sequence ENSEMBL: ENSMUSP00000074190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074608]
Predicted Effect probably damaging
Transcript: ENSMUST00000074608
AA Change: S93P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074190
Gene: ENSMUSG00000061633
AA Change: S93P

DomainStartEndE-ValueType
Pfam:ESSS 19 130 6.9e-40 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appbp2 G C 11: 85,210,095 R173G possibly damaging Het
Bcl11a A G 11: 24,163,932 K425R probably damaging Het
Casr A G 16: 36,494,744 M911T probably benign Het
Cdon C T 9: 35,504,081 A1205V probably benign Het
Chfr T C 5: 110,153,282 probably null Het
Dixdc1 A G 9: 50,669,480 L638P probably damaging Het
Filip1 C T 9: 79,819,760 V526M possibly damaging Het
Fsip2 T A 2: 82,998,128 D6756E possibly damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Lvrn A G 18: 46,890,865 T760A probably benign Het
Myh7 T A 14: 54,978,954 M1256L probably benign Het
Olfr146 T A 9: 39,018,702 I280F probably damaging Het
Pdia5 T C 16: 35,449,442 R166G probably benign Het
Plcz1 A G 6: 140,023,125 Y196H probably damaging Het
Ptpn12 T A 5: 21,015,726 E135D probably damaging Het
Rnh1 T C 7: 141,163,381 D191G probably benign Het
Slit1 A G 19: 41,616,663 probably null Het
Syne2 T G 12: 75,945,085 D1941E probably benign Het
Thsd4 C A 9: 59,972,458 A639S possibly damaging Het
Other mutations in 1700029P11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1836:1700029P11Rik UTSW 15 81980867 missense probably damaging 0.97
R5888:1700029P11Rik UTSW 15 81980671 missense probably benign 0.03
R6556:1700029P11Rik UTSW 15 81980738 missense probably damaging 0.99
R8317:1700029P11Rik UTSW 15 81980777 missense probably damaging 1.00
R8386:1700029P11Rik UTSW 15 81980629 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGCCTTTCCGCAATTCGAC -3'
(R):5'- TCCAGCAGGTTGATCTTGG -3'

Sequencing Primer
(F):5'- TGGAAATCCAGCTCCTCCAGG -3'
(R):5'- GTGGGGTCAAAATAGTTGGACTCC -3'
Posted On2016-10-26