Incidental Mutation 'R0071:Tdrd12'
ID 43848
Institutional Source Beutler Lab
Gene Symbol Tdrd12
Ensembl Gene ENSMUSG00000030491
Gene Name tudor domain containing 12
Synonyms EG434165, 2410004F06Rik, ecat8, repro23, G1-476-14, 2410070K17Rik
MMRRC Submission 038362-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.141) question?
Stock # R0071 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 35168523-35237170 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 35228671 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 17 (V17A)
Ref Sequence ENSEMBL: ENSMUSP00000032701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032701] [ENSMUST00000127472] [ENSMUST00000187190] [ENSMUST00000193633] [ENSMUST00000205407]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000032701
AA Change: V17A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032701
Gene: ENSMUSG00000030491
AA Change: V17A

DomainStartEndE-ValueType
Pfam:TUDOR 1 129 4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127472
SMART Domains Protein: ENSMUSP00000118671
Gene: ENSMUSG00000030491

DomainStartEndE-ValueType
Pfam:TUDOR 3 76 6.3e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000187190
AA Change: V17A

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140328
Gene: ENSMUSG00000030491
AA Change: V17A

DomainStartEndE-ValueType
Pfam:TUDOR 1 129 5.1e-24 PFAM
Pfam:DEAD 276 581 1.8e-6 PFAM
Pfam:TUDOR 852 973 4.9e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000193633
AA Change: V17A

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141796
Gene: ENSMUSG00000030491
AA Change: V17A

DomainStartEndE-ValueType
Pfam:TUDOR 1 129 2.7e-24 PFAM
Pfam:DEAD 273 606 7.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205407
Meta Mutation Damage Score 0.0765 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.2%
Validation Efficiency 99% (78/79)
MGI Phenotype PHENOTYPE: Homozygous males are infertile with small testes. Spermatogenesis is arrested predominantly at the pachytene spermatocyte stage. Retrotransposon hopping is derepressed in germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A G 14: 35,812,746 (GRCm39) probably benign Het
Acot12 T C 13: 91,929,293 (GRCm39) probably benign Het
Acrbp T C 6: 125,027,915 (GRCm39) probably benign Het
Amotl1 G A 9: 14,460,069 (GRCm39) A890V probably benign Het
Aox3 T A 1: 58,211,050 (GRCm39) C931* probably null Het
Apob T A 12: 8,052,111 (GRCm39) V1184E probably damaging Het
Arhgap44 A T 11: 64,902,721 (GRCm39) L582Q possibly damaging Het
Bbx C T 16: 50,100,755 (GRCm39) E47K probably benign Het
Bccip A G 7: 133,315,960 (GRCm39) D72G probably damaging Het
Bckdha A T 7: 25,329,868 (GRCm39) probably null Het
Bmerb1 A G 16: 13,906,818 (GRCm39) D11G probably damaging Het
Cald1 C T 6: 34,735,069 (GRCm39) probably benign Het
Cby2 A G 14: 75,821,621 (GRCm39) S44P probably benign Het
Cdk11b T C 4: 155,733,880 (GRCm39) probably benign Het
Cebpe G T 14: 54,948,061 (GRCm39) R261S probably damaging Het
Cep95 C T 11: 106,681,554 (GRCm39) probably benign Het
Chi3l1 T C 1: 134,113,017 (GRCm39) Y150H probably benign Het
Chrnd T C 1: 87,120,559 (GRCm39) probably benign Het
Clec4g T A 8: 3,767,489 (GRCm39) probably benign Het
Cog2 T C 8: 125,275,407 (GRCm39) probably benign Het
Coro7 A T 16: 4,488,391 (GRCm39) L93Q probably damaging Het
Csmd3 T C 15: 47,460,217 (GRCm39) T3525A probably benign Het
Ctsc G A 7: 87,957,357 (GRCm39) probably benign Het
Dnajc16 T C 4: 141,495,318 (GRCm39) T467A probably benign Het
Dnmt1 G A 9: 20,819,916 (GRCm39) T1409I probably damaging Het
Fam227b T A 2: 125,965,994 (GRCm39) N144Y probably benign Het
Fam83h A G 15: 75,874,377 (GRCm39) S987P probably benign Het
Fhod1 A T 8: 106,063,857 (GRCm39) probably null Het
Folr1 A G 7: 101,513,130 (GRCm39) probably null Het
Glis3 C T 19: 28,241,255 (GRCm39) probably benign Het
Gm10069 T C 6: 128,449,688 (GRCm39) noncoding transcript Het
Golgb1 G A 16: 36,735,865 (GRCm39) R1704Q probably benign Het
Gpr158 C A 2: 21,815,479 (GRCm39) T624K probably benign Het
Helz2 T C 2: 180,878,200 (GRCm39) Y866C probably damaging Het
Itpkb T A 1: 180,160,330 (GRCm39) V152E probably damaging Het
Kcnma1 C T 14: 23,576,835 (GRCm39) R236H probably damaging Het
Klhl32 A G 4: 24,743,907 (GRCm39) V88A probably damaging Het
Lct C T 1: 128,219,755 (GRCm39) W1631* probably null Het
Lipa T A 19: 34,472,482 (GRCm39) K313M probably damaging Het
Ly75 T C 2: 60,152,163 (GRCm39) K1130R probably benign Het
Mamdc2 C A 19: 23,280,994 (GRCm39) E685* probably null Het
Mdm1 A G 10: 117,982,701 (GRCm39) E112G probably damaging Het
Metrnl A T 11: 121,606,826 (GRCm39) M212L probably benign Het
Mettl2 A G 11: 105,022,468 (GRCm39) probably benign Het
Mxd3 A T 13: 55,477,449 (GRCm39) L11Q probably damaging Het
Myo7a A T 7: 97,706,037 (GRCm39) Y1836N probably damaging Het
Nsun7 A G 5: 66,421,388 (GRCm39) Y118C probably benign Het
Obscn G A 11: 58,955,027 (GRCm39) T3962M possibly damaging Het
Or13a20 A T 7: 140,232,170 (GRCm39) I93F probably benign Het
Or2d36 A G 7: 106,746,919 (GRCm39) Y132C probably damaging Het
Or5k3 C A 16: 58,969,578 (GRCm39) R122S probably benign Het
Osbpl11 T C 16: 33,034,708 (GRCm39) probably benign Het
Pcdhb22 A T 18: 37,653,131 (GRCm39) D276V probably damaging Het
Pik3cb A T 9: 98,926,918 (GRCm39) D886E probably benign Het
Pkhd1 T A 1: 20,271,568 (GRCm39) Y2995F probably benign Het
Raver2 C T 4: 100,977,642 (GRCm39) probably benign Het
Rhbdf1 A G 11: 32,160,498 (GRCm39) L684P probably damaging Het
Rufy2 C A 10: 62,824,946 (GRCm39) L75M possibly damaging Het
Sec22c A G 9: 121,521,979 (GRCm39) F44L probably damaging Het
Sephs1 A G 2: 4,904,371 (GRCm39) T250A probably benign Het
Serpina1a T C 12: 103,822,002 (GRCm39) K310R probably benign Het
Shoc1 A G 4: 59,059,643 (GRCm39) Y1006H possibly damaging Het
Sobp A G 10: 43,033,993 (GRCm39) L111P probably damaging Het
Sparcl1 G T 5: 104,233,707 (GRCm39) Y547* probably null Het
Spata31d1b G A 13: 59,863,163 (GRCm39) A104T probably benign Het
Spsb3 A G 17: 25,106,878 (GRCm39) D184G probably damaging Het
Sptan1 A T 2: 29,893,354 (GRCm39) K1148* probably null Het
Tlr9 A G 9: 106,100,777 (GRCm39) T23A probably benign Het
Tra2b A T 16: 22,073,151 (GRCm39) probably benign Het
Tspan15 A G 10: 62,038,849 (GRCm39) probably benign Het
Ttc41 A G 10: 86,572,710 (GRCm39) N694S probably benign Het
Ttn T G 2: 76,597,813 (GRCm39) D19700A probably damaging Het
Ube3b G A 5: 114,557,558 (GRCm39) G1014D probably damaging Het
Unc5d A G 8: 29,209,854 (GRCm39) V422A possibly damaging Het
Vmn2r80 C T 10: 79,007,566 (GRCm39) T514I possibly damaging Het
Zfp595 T C 13: 67,464,917 (GRCm39) K452E possibly damaging Het
Zfp607a A G 7: 27,577,694 (GRCm39) K255E probably damaging Het
Zxdc T G 6: 90,347,398 (GRCm39) V253G probably damaging Het
Other mutations in Tdrd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Tdrd12 APN 7 35,204,459 (GRCm39) missense possibly damaging 0.95
IGL01879:Tdrd12 APN 7 35,221,348 (GRCm39) missense probably damaging 1.00
IGL02026:Tdrd12 APN 7 35,203,658 (GRCm39) splice site probably benign
IGL02186:Tdrd12 APN 7 35,200,826 (GRCm39) missense probably damaging 0.99
PIT4131001:Tdrd12 UTSW 7 35,180,528 (GRCm39) nonsense probably null
R0071:Tdrd12 UTSW 7 35,228,671 (GRCm39) missense possibly damaging 0.92
R0098:Tdrd12 UTSW 7 35,175,418 (GRCm39) missense probably damaging 1.00
R0366:Tdrd12 UTSW 7 35,208,227 (GRCm39) missense probably benign 0.25
R2050:Tdrd12 UTSW 7 35,228,672 (GRCm39) missense probably damaging 0.98
R2851:Tdrd12 UTSW 7 35,184,798 (GRCm39) missense probably damaging 1.00
R3715:Tdrd12 UTSW 7 35,204,405 (GRCm39) missense probably benign 0.05
R3859:Tdrd12 UTSW 7 35,193,245 (GRCm39) missense possibly damaging 0.50
R3912:Tdrd12 UTSW 7 35,187,138 (GRCm39) missense probably damaging 1.00
R4656:Tdrd12 UTSW 7 35,184,679 (GRCm39) missense probably damaging 1.00
R4826:Tdrd12 UTSW 7 35,203,582 (GRCm39) missense probably benign 0.00
R4969:Tdrd12 UTSW 7 35,186,720 (GRCm39) splice site probably null
R5202:Tdrd12 UTSW 7 35,189,455 (GRCm39) missense possibly damaging 0.49
R5321:Tdrd12 UTSW 7 35,177,519 (GRCm39) missense probably damaging 1.00
R5642:Tdrd12 UTSW 7 35,210,725 (GRCm39) missense probably damaging 0.99
R5709:Tdrd12 UTSW 7 35,175,478 (GRCm39) missense probably damaging 1.00
R5835:Tdrd12 UTSW 7 35,228,689 (GRCm39) missense probably damaging 1.00
R6029:Tdrd12 UTSW 7 35,184,655 (GRCm39) missense probably damaging 0.98
R6101:Tdrd12 UTSW 7 35,180,558 (GRCm39) nonsense probably null
R6341:Tdrd12 UTSW 7 35,189,473 (GRCm39) missense probably damaging 1.00
R6631:Tdrd12 UTSW 7 35,184,654 (GRCm39) missense probably damaging 0.99
R6939:Tdrd12 UTSW 7 35,185,024 (GRCm39) critical splice donor site probably null
R7032:Tdrd12 UTSW 7 35,180,471 (GRCm39) nonsense probably null
R7058:Tdrd12 UTSW 7 35,177,534 (GRCm39) missense unknown
R7096:Tdrd12 UTSW 7 35,187,014 (GRCm39) missense
R7203:Tdrd12 UTSW 7 35,188,648 (GRCm39) nonsense probably null
R7229:Tdrd12 UTSW 7 35,179,705 (GRCm39) missense unknown
R7265:Tdrd12 UTSW 7 35,187,147 (GRCm39) missense
R7284:Tdrd12 UTSW 7 35,179,561 (GRCm39) splice site probably null
R7347:Tdrd12 UTSW 7 35,185,117 (GRCm39) missense
R7501:Tdrd12 UTSW 7 35,177,516 (GRCm39) missense unknown
R7789:Tdrd12 UTSW 7 35,188,117 (GRCm39) missense
R8374:Tdrd12 UTSW 7 35,177,486 (GRCm39) missense unknown
R8379:Tdrd12 UTSW 7 35,223,482 (GRCm39) nonsense probably null
R8798:Tdrd12 UTSW 7 35,228,605 (GRCm39) missense probably damaging 1.00
R9053:Tdrd12 UTSW 7 35,204,468 (GRCm39) missense probably damaging 1.00
R9062:Tdrd12 UTSW 7 35,179,694 (GRCm39) missense unknown
R9491:Tdrd12 UTSW 7 35,188,689 (GRCm39) missense
R9745:Tdrd12 UTSW 7 35,185,964 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GAGAACCTTGCCTAACCATCCTCTTC -3'
(R):5'- cccactgcttcagtctGACCATTT -3'

Sequencing Primer
(F):5'- cagaagggcgagtgtagg -3'
(R):5'- cttcagtctGACCATTTAAGACAAAG -3'
Posted On 2013-05-29