Incidental Mutation 'R0071:Tdrd12'
ID 43848
Institutional Source Beutler Lab
Gene Symbol Tdrd12
Ensembl Gene ENSMUSG00000030491
Gene Name tudor domain containing 12
Synonyms EG434165, 2410070K17Rik, ecat8, 2410004F06Rik, G1-476-14, repro23
MMRRC Submission 038362-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock # R0071 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 35469098-35537745 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 35529246 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 17 (V17A)
Ref Sequence ENSEMBL: ENSMUSP00000032701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032701] [ENSMUST00000127472] [ENSMUST00000187190] [ENSMUST00000193633] [ENSMUST00000205407]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000032701
AA Change: V17A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032701
Gene: ENSMUSG00000030491
AA Change: V17A

DomainStartEndE-ValueType
Pfam:TUDOR 1 129 4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127472
SMART Domains Protein: ENSMUSP00000118671
Gene: ENSMUSG00000030491

DomainStartEndE-ValueType
Pfam:TUDOR 3 76 6.3e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000187190
AA Change: V17A

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140328
Gene: ENSMUSG00000030491
AA Change: V17A

DomainStartEndE-ValueType
Pfam:TUDOR 1 129 5.1e-24 PFAM
Pfam:DEAD 276 581 1.8e-6 PFAM
Pfam:TUDOR 852 973 4.9e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000193633
AA Change: V17A

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141796
Gene: ENSMUSG00000030491
AA Change: V17A

DomainStartEndE-ValueType
Pfam:TUDOR 1 129 2.7e-24 PFAM
Pfam:DEAD 273 606 7.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205407
Meta Mutation Damage Score 0.0765 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.2%
Validation Efficiency 99% (78/79)
MGI Phenotype PHENOTYPE: Homozygous males are infertile with small testes. Spermatogenesis is arrested predominantly at the pachytene spermatocyte stage. Retrotransposon hopping is derepressed in germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik A G 16: 14,088,954 D11G probably damaging Het
4930474N05Rik A G 14: 36,090,789 probably benign Het
Acot12 T C 13: 91,781,174 probably benign Het
Acrbp T C 6: 125,050,952 probably benign Het
AI481877 A G 4: 59,059,643 Y1006H possibly damaging Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Aox3 T A 1: 58,171,891 C931* probably null Het
Apob T A 12: 8,002,111 V1184E probably damaging Het
Arhgap44 A T 11: 65,011,895 L582Q possibly damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Bccip A G 7: 133,714,231 D72G probably damaging Het
Bckdha A T 7: 25,630,443 probably null Het
Cald1 C T 6: 34,758,134 probably benign Het
Cdk11b T C 4: 155,649,423 probably benign Het
Cebpe G T 14: 54,710,604 R261S probably damaging Het
Cep95 C T 11: 106,790,728 probably benign Het
Chil1 T C 1: 134,185,279 Y150H probably benign Het
Chrnd T C 1: 87,192,837 probably benign Het
Clec4g T A 8: 3,717,489 probably benign Het
Cog2 T C 8: 124,548,668 probably benign Het
Coro7 A T 16: 4,670,527 L93Q probably damaging Het
Csmd3 T C 15: 47,596,821 T3525A probably benign Het
Ctsc G A 7: 88,308,149 probably benign Het
Dnajc16 T C 4: 141,768,007 T467A probably benign Het
Dnmt1 G A 9: 20,908,620 T1409I probably damaging Het
Fam227b T A 2: 126,124,074 N144Y probably benign Het
Fam83h A G 15: 76,002,528 S987P probably benign Het
Fhod1 A T 8: 105,337,225 probably null Het
Folr1 A G 7: 101,863,923 probably null Het
Glis3 C T 19: 28,263,855 probably benign Het
Gm10069 T C 6: 128,472,725 noncoding transcript Het
Golgb1 G A 16: 36,915,503 R1704Q probably benign Het
Gpr158 C A 2: 21,810,668 T624K probably benign Het
Helz2 T C 2: 181,236,407 Y866C probably damaging Het
Itpkb T A 1: 180,332,765 V152E probably damaging Het
Kcnma1 C T 14: 23,526,767 R236H probably damaging Het
Klhl32 A G 4: 24,743,907 V88A probably damaging Het
Lct C T 1: 128,292,018 W1631* probably null Het
Lipa T A 19: 34,495,082 K313M probably damaging Het
Ly75 T C 2: 60,321,819 K1130R probably benign Het
Mamdc2 C A 19: 23,303,630 E685* probably null Het
Mdm1 A G 10: 118,146,796 E112G probably damaging Het
Metrnl A T 11: 121,716,000 M212L probably benign Het
Mettl2 A G 11: 105,131,642 probably benign Het
Mxd3 A T 13: 55,329,636 L11Q probably damaging Het
Myo7a A T 7: 98,056,830 Y1836N probably damaging Het
Nsun7 A G 5: 66,264,045 Y118C probably benign Het
Obscn G A 11: 59,064,201 T3962M possibly damaging Het
Olfr195 C A 16: 59,149,215 R122S probably benign Het
Olfr53 A T 7: 140,652,257 I93F probably benign Het
Olfr716 A G 7: 107,147,712 Y132C probably damaging Het
Osbpl11 T C 16: 33,214,338 probably benign Het
Pcdhb22 A T 18: 37,520,078 D276V probably damaging Het
Pik3cb A T 9: 99,044,865 D886E probably benign Het
Pkhd1 T A 1: 20,201,344 Y2995F probably benign Het
Raver2 C T 4: 101,120,445 probably benign Het
Rhbdf1 A G 11: 32,210,498 L684P probably damaging Het
Rufy2 C A 10: 62,989,167 L75M possibly damaging Het
Sec22c A G 9: 121,692,913 F44L probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpina1a T C 12: 103,855,743 K310R probably benign Het
Sobp A G 10: 43,157,997 L111P probably damaging Het
Sparcl1 G T 5: 104,085,841 Y547* probably null Het
Spata31d1b G A 13: 59,715,349 A104T probably benign Het
Spert A G 14: 75,584,181 S44P probably benign Het
Spsb3 A G 17: 24,887,904 D184G probably damaging Het
Sptan1 A T 2: 30,003,342 K1148* probably null Het
Tlr9 A G 9: 106,223,578 T23A probably benign Het
Tra2b A T 16: 22,254,401 probably benign Het
Tspan15 A G 10: 62,203,070 probably benign Het
Ttc41 A G 10: 86,736,846 N694S probably benign Het
Ttn T G 2: 76,767,469 D19700A probably damaging Het
Ube3b G A 5: 114,419,497 G1014D probably damaging Het
Unc5d A G 8: 28,719,826 V422A possibly damaging Het
Vmn2r80 C T 10: 79,171,732 T514I possibly damaging Het
Zfp595 T C 13: 67,316,853 K452E possibly damaging Het
Zfp607a A G 7: 27,878,269 K255E probably damaging Het
Zxdc T G 6: 90,370,416 V253G probably damaging Het
Other mutations in Tdrd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Tdrd12 APN 7 35505034 missense possibly damaging 0.95
IGL01879:Tdrd12 APN 7 35521923 missense probably damaging 1.00
IGL02026:Tdrd12 APN 7 35504233 splice site probably benign
IGL02186:Tdrd12 APN 7 35501401 missense probably damaging 0.99
PIT4131001:Tdrd12 UTSW 7 35481103 nonsense probably null
R0071:Tdrd12 UTSW 7 35529246 missense possibly damaging 0.92
R0098:Tdrd12 UTSW 7 35475993 missense probably damaging 1.00
R0366:Tdrd12 UTSW 7 35508802 missense probably benign 0.25
R2050:Tdrd12 UTSW 7 35529247 missense probably damaging 0.98
R2851:Tdrd12 UTSW 7 35485373 missense probably damaging 1.00
R3715:Tdrd12 UTSW 7 35504980 missense probably benign 0.05
R3859:Tdrd12 UTSW 7 35493820 missense possibly damaging 0.50
R3912:Tdrd12 UTSW 7 35487713 missense probably damaging 1.00
R4656:Tdrd12 UTSW 7 35485254 missense probably damaging 1.00
R4826:Tdrd12 UTSW 7 35504157 missense probably benign 0.00
R4969:Tdrd12 UTSW 7 35487295 splice site probably null
R5202:Tdrd12 UTSW 7 35490030 missense possibly damaging 0.49
R5321:Tdrd12 UTSW 7 35478094 missense probably damaging 1.00
R5642:Tdrd12 UTSW 7 35511300 missense probably damaging 0.99
R5709:Tdrd12 UTSW 7 35476053 missense probably damaging 1.00
R5835:Tdrd12 UTSW 7 35529264 missense probably damaging 1.00
R6029:Tdrd12 UTSW 7 35485230 missense probably damaging 0.98
R6101:Tdrd12 UTSW 7 35481133 nonsense probably null
R6341:Tdrd12 UTSW 7 35490048 missense probably damaging 1.00
R6631:Tdrd12 UTSW 7 35485229 missense probably damaging 0.99
R6939:Tdrd12 UTSW 7 35485599 critical splice donor site probably null
R7032:Tdrd12 UTSW 7 35481046 nonsense probably null
R7058:Tdrd12 UTSW 7 35478109 missense unknown
R7096:Tdrd12 UTSW 7 35487589 missense
R7203:Tdrd12 UTSW 7 35489223 nonsense probably null
R7229:Tdrd12 UTSW 7 35480280 missense unknown
R7265:Tdrd12 UTSW 7 35487722 missense
R7284:Tdrd12 UTSW 7 35480136 splice site probably null
R7347:Tdrd12 UTSW 7 35485692 missense
R7501:Tdrd12 UTSW 7 35478091 missense unknown
R7789:Tdrd12 UTSW 7 35488692 missense
R8374:Tdrd12 UTSW 7 35478061 missense unknown
R8379:Tdrd12 UTSW 7 35524057 nonsense probably null
R8798:Tdrd12 UTSW 7 35529180 missense probably damaging 1.00
R9053:Tdrd12 UTSW 7 35505043 missense probably damaging 1.00
R9062:Tdrd12 UTSW 7 35480269 missense unknown
R9491:Tdrd12 UTSW 7 35489264 missense
R9745:Tdrd12 UTSW 7 35486539 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GAGAACCTTGCCTAACCATCCTCTTC -3'
(R):5'- cccactgcttcagtctGACCATTT -3'

Sequencing Primer
(F):5'- cagaagggcgagtgtagg -3'
(R):5'- cttcagtctGACCATTTAAGACAAAG -3'
Posted On 2013-05-29