Incidental Mutation 'R5582:H3f3a'
ID438484
Institutional Source Beutler Lab
Gene Symbol H3f3a
Ensembl Gene ENSMUSG00000060743
Gene NameH3 histone, family 3A
SynonymsH3.3A
MMRRC Submission 043136-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.453) question?
Stock #R5582 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location180800832-180813943 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 180810085 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081026] [ENSMUST00000159685] [ENSMUST00000159789] [ENSMUST00000161308] [ENSMUST00000162118] [ENSMUST00000162814]
Predicted Effect probably benign
Transcript: ENSMUST00000081026
SMART Domains Protein: ENSMUSP00000079816
Gene: ENSMUSG00000060743

DomainStartEndE-ValueType
H3 34 135 2.77e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159441
Predicted Effect probably benign
Transcript: ENSMUST00000159685
SMART Domains Protein: ENSMUSP00000124040
Gene: ENSMUSG00000060743

DomainStartEndE-ValueType
PDB:4HGA|B 1 52 7e-30 PDB
Blast:H3 8 52 9e-23 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159740
Predicted Effect probably benign
Transcript: ENSMUST00000159789
SMART Domains Protein: ENSMUSP00000125754
Gene: ENSMUSG00000060743

DomainStartEndE-ValueType
H3 34 119 8.9e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161308
SMART Domains Protein: ENSMUSP00000124509
Gene: ENSMUSG00000060743

DomainStartEndE-ValueType
H3 34 136 4.79e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162118
SMART Domains Protein: ENSMUSP00000123946
Gene: ENSMUSG00000060743

DomainStartEndE-ValueType
PDB:4HGA|B 1 55 3e-32 PDB
Blast:H3 8 52 1e-22 BLAST
SCOP:d1hq3c_ 42 55 9e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162814
SMART Domains Protein: ENSMUSP00000125104
Gene: ENSMUSG00000060743

DomainStartEndE-ValueType
H3 34 136 4.79e-74 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181811
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene contains introns and its mRNA is polyadenylated, unlike most histone genes. The protein encoded is a replication-independent member of the histone H3 family. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous mutants for a hypomorphic gene trap allele display partial neonatal lethality, reduced fertility, growth abnormalities and neuromuscular defects. Mice homozygous for a reporter allele exhibit reduced body size and male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,636,639 probably null Het
Agxt2 A G 15: 10,399,159 D444G probably damaging Het
Aldh1b1 G T 4: 45,802,750 R96L probably damaging Het
Ank2 T C 3: 126,946,305 probably benign Het
Apob A G 12: 8,010,788 Y3090C probably damaging Het
Bbx A G 16: 50,223,356 S647P probably damaging Het
Brinp2 T C 1: 158,249,409 Y372C probably damaging Het
Btaf1 T C 19: 36,988,173 probably null Het
Cdk5rap1 T A 2: 154,345,974 E477D probably benign Het
Cfap65 G A 1: 74,907,518 probably benign Het
Chdh A G 14: 30,036,859 Y587C probably damaging Het
Chek2 T C 5: 110,868,035 V472A probably damaging Het
Clasrp A C 7: 19,586,856 I326S probably damaging Het
Clic6 A T 16: 92,499,454 Q334L possibly damaging Het
Cyp2d11 A T 15: 82,392,118 probably null Het
Entpd7 T C 19: 43,704,994 I171T probably damaging Het
Fosl1 T C 19: 5,455,267 probably benign Het
Gm10130 T C 2: 150,363,052 probably benign Het
Gm6124 A G 7: 39,220,198 noncoding transcript Het
Hs1bp3 AGAGGAGGAGGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGGAGGAGGAGG 12: 8,324,048 probably benign Het
Idh2 CCAGGGC CC 7: 80,098,339 probably null Het
Igkv3-7 A G 6: 70,608,006 Y110C probably damaging Het
Ints9 C T 14: 65,028,896 T399M possibly damaging Het
Kctd19 G A 8: 105,408,443 T62M probably damaging Het
Lsmem1 A G 12: 40,180,644 probably null Het
Obscn T C 11: 59,099,976 probably null Het
Olfr340 T C 2: 36,453,221 I212T probably benign Het
Olfr748 T C 14: 50,710,968 Y213H probably damaging Het
Otop3 T A 11: 115,339,339 M14K unknown Het
Pibf1 C T 14: 99,137,130 A335V possibly damaging Het
Pkd1l2 A T 8: 117,040,783 L1256* probably null Het
Plbd2 T C 5: 120,493,106 E202G probably benign Het
Ppp1r37 A G 7: 19,532,294 S516P probably damaging Het
Ppt2 G A 17: 34,617,399 T229M probably damaging Het
Prr14 A T 7: 127,476,397 I526F probably damaging Het
Scel T C 14: 103,583,139 probably benign Het
Scn9a A T 2: 66,565,029 probably benign Het
Senp6 T A 9: 80,089,876 D57E possibly damaging Het
Setd5 T C 6: 113,114,925 Y217H probably damaging Het
Sgcg T C 14: 61,225,305 T198A probably damaging Het
Sipa1 C T 19: 5,654,701 G622D probably benign Het
Slc27a2 C T 2: 126,564,690 A98V probably damaging Het
Slitrk3 G T 3: 73,050,404 P345Q probably benign Het
Slx4 T C 16: 3,985,788 D1054G possibly damaging Het
Sned1 A T 1: 93,282,361 T898S probably damaging Het
Tg C T 15: 66,693,435 P1209S probably damaging Het
Tmem63b C A 17: 45,667,763 V294L probably benign Het
Tnks G A 8: 34,940,861 R238C probably benign Het
Tsn G A 1: 118,305,214 T120I probably damaging Het
Txnrd1 T A 10: 82,895,980 F479I possibly damaging Het
Ubr1 T C 2: 120,915,407 M849V probably benign Het
Usp13 T C 3: 32,911,589 S574P probably damaging Het
Vmn1r69 A G 7: 10,580,508 Y20H probably damaging Het
Zfp780b T A 7: 27,964,827 N101I probably damaging Het
Other mutations in H3f3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2297:H3f3a UTSW 1 180803138 missense probably benign 0.00
R2298:H3f3a UTSW 1 180803138 missense probably benign 0.00
R2299:H3f3a UTSW 1 180803138 missense probably benign 0.00
R2300:H3f3a UTSW 1 180803138 missense probably benign 0.00
R2351:H3f3a UTSW 1 180810158 missense probably benign
R2895:H3f3a UTSW 1 180803138 missense probably benign 0.00
R4052:H3f3a UTSW 1 180803138 missense probably benign 0.00
R4208:H3f3a UTSW 1 180803138 missense probably benign 0.00
R4455:H3f3a UTSW 1 180803103 missense probably benign 0.00
R7870:H3f3a UTSW 1 180811925 start codon destroyed probably null 0.61
Predicted Primers PCR Primer
(F):5'- GCATTAGGCTTTTGAACCAATTAGG -3'
(R):5'- CTCCGTGAAATCAGACGCTATC -3'

Sequencing Primer
(F):5'- ATCTTACTTTGGAGACCAGGC -3'
(R):5'- GCTATCAGAAGTCCACTGAACTTCTG -3'
Posted On2016-10-26