Mutagenetix > Incidental Mutation

Incidental Mutation 'R5582:Usp13'

438491

Institutional Source

Beutler Lab

Gene Symbol

Usp13

Ensembl Gene

ENSMUSG00000056900

Gene Name

ubiquitin specific peptidase 13 (isopeptidase T-3)

Synonyms

ISOT3, 2700071E21Rik, IsoT-3

MMRRC Submission

043136-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5582 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32817546-32938071 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 32911589 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 574 (S574P)

Ref Sequence

ENSEMBL: ENSMUSP00000072155 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072312] [ENSMUST00000108228] [ENSMUST00000172481]

AlphaFold

Q5BKP2

Predicted Effect

probably damaging
Transcript: ENSMUST00000072312
AA Change: S574P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000072155
Gene: ENSMUSG00000056900
AA Change: S574P

Domain	Start	End	E-Value	Type
low complexity region	12	23	N/A	INTRINSIC
Blast:ZnF_UBP	46	91	1e-17	BLAST
low complexity region	116	134	N/A	INTRINSIC
ZnF_UBP	208	263	2.91e-20	SMART
low complexity region	625	639	N/A	INTRINSIC
UBA	652	690	1.25e-6	SMART
UBA	724	761	1.19e-12	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000108228
AA Change: S573P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000103863
Gene: ENSMUSG00000056900
AA Change: S573P

Domain	Start	End	E-Value	Type
low complexity region	12	23	N/A	INTRINSIC
Blast:ZnF_UBP	46	91	1e-17	BLAST
low complexity region	115	133	N/A	INTRINSIC
ZnF_UBP	207	262	2.91e-20	SMART
low complexity region	624	638	N/A	INTRINSIC
UBA	651	689	1.25e-6	SMART
UBA	723	760	1.19e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000156769

SMART Domains

Protein: ENSMUSP00000117605
Gene: ENSMUSG00000056900

Domain	Start	End	E-Value	Type
UBA	9	47	1.25e-6	SMART
UBA	81	118	1.19e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000172481

SMART Domains

Protein: ENSMUSP00000133823
Gene: ENSMUSG00000056900

Domain	Start	End	E-Value	Type
low complexity region	12	23	N/A	INTRINSIC
Blast:ZnF_UBP	46	91	9e-18	BLAST
low complexity region	116	134	N/A	INTRINSIC
ZnF_UBP	208	263	2.91e-20	SMART
Pfam:UCH	333	523	5.1e-27	PFAM

Meta Mutation Damage Score

0.6358

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.6%

Validation Efficiency

98% (61/62)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	C	11: 9,636,639		probably null	Het
Agxt2	A	G	15: 10,399,159	D444G	probably damaging	Het
Aldh1b1	G	T	4: 45,802,750	R96L	probably damaging	Het
Ank2	T	C	3: 126,946,305		probably benign	Het
Apob	A	G	12: 8,010,788	Y3090C	probably damaging	Het
Bbx	A	G	16: 50,223,356	S647P	probably damaging	Het
Brinp2	T	C	1: 158,249,409	Y372C	probably damaging	Het
Btaf1	T	C	19: 36,988,173		probably null	Het
Cdk5rap1	T	A	2: 154,345,974	E477D	probably benign	Het
Cfap65	G	A	1: 74,907,518		probably benign	Het
Chdh	A	G	14: 30,036,859	Y587C	probably damaging	Het
Chek2	T	C	5: 110,868,035	V472A	probably damaging	Het
Clasrp	A	C	7: 19,586,856	I326S	probably damaging	Het
Clic6	A	T	16: 92,499,454	Q334L	possibly damaging	Het
Cyp2d11	A	T	15: 82,392,118		probably null	Het
Entpd7	T	C	19: 43,704,994	I171T	probably damaging	Het
Fosl1	T	C	19: 5,455,267		probably benign	Het
Gm10130	T	C	2: 150,363,052		probably benign	Het
Gm6124	A	G	7: 39,220,198		noncoding transcript	Het
H3f3a	A	T	1: 180,810,085		probably benign	Het
Hs1bp3	AGAGGAGGAGGAGGAGGAGGAGGAGGAGG	AGAGGAGGAGGAGGAGGAGGAGGAGG	12: 8,324,048		probably benign	Het
Idh2	CCAGGGC	CC	7: 80,098,339		probably null	Het
Igkv3-7	A	G	6: 70,608,006	Y110C	probably damaging	Het
Ints9	C	T	14: 65,028,896	T399M	possibly damaging	Het
Kctd19	G	A	8: 105,408,443	T62M	probably damaging	Het
Lsmem1	A	G	12: 40,180,644		probably null	Het
Obscn	T	C	11: 59,099,976		probably null	Het
Olfr340	T	C	2: 36,453,221	I212T	probably benign	Het
Olfr748	T	C	14: 50,710,968	Y213H	probably damaging	Het
Otop3	T	A	11: 115,339,339	M14K	unknown	Het
Pibf1	C	T	14: 99,137,130	A335V	possibly damaging	Het
Pkd1l2	A	T	8: 117,040,783	L1256*	probably null	Het
Plbd2	T	C	5: 120,493,106	E202G	probably benign	Het
Ppp1r37	A	G	7: 19,532,294	S516P	probably damaging	Het
Ppt2	G	A	17: 34,617,399	T229M	probably damaging	Het
Prr14	A	T	7: 127,476,397	I526F	probably damaging	Het
Scel	T	C	14: 103,583,139		probably benign	Het
Scn9a	A	T	2: 66,565,029		probably benign	Het
Senp6	T	A	9: 80,089,876	D57E	possibly damaging	Het
Setd5	T	C	6: 113,114,925	Y217H	probably damaging	Het
Sgcg	T	C	14: 61,225,305	T198A	probably damaging	Het
Sipa1	C	T	19: 5,654,701	G622D	probably benign	Het
Slc27a2	C	T	2: 126,564,690	A98V	probably damaging	Het
Slitrk3	G	T	3: 73,050,404	P345Q	probably benign	Het
Slx4	T	C	16: 3,985,788	D1054G	possibly damaging	Het
Sned1	A	T	1: 93,282,361	T898S	probably damaging	Het
Tg	C	T	15: 66,693,435	P1209S	probably damaging	Het
Tmem63b	C	A	17: 45,667,763	V294L	probably benign	Het
Tnks	G	A	8: 34,940,861	R238C	probably benign	Het
Tsn	G	A	1: 118,305,214	T120I	probably damaging	Het
Txnrd1	T	A	10: 82,895,980	F479I	possibly damaging	Het
Ubr1	T	C	2: 120,915,407	M849V	probably benign	Het
Vmn1r69	A	G	7: 10,580,508	Y20H	probably damaging	Het
Zfp780b	T	A	7: 27,964,827	N101I	probably damaging	Het

Other mutations in Usp13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Usp13	APN	3	32881411	missense	probably damaging	0.98
IGL00949:Usp13	APN	3	32886577	missense	possibly damaging	0.57
IGL01637:Usp13	APN	3	32919064	missense	probably benign	0.02
IGL01983:Usp13	APN	3	32917459	missense	probably damaging	1.00
IGL02002:Usp13	APN	3	32847825	missense	probably damaging	0.97
IGL02065:Usp13	APN	3	32933165	missense	probably damaging	1.00
IGL02390:Usp13	APN	3	32931716	nonsense	probably null
IGL02399:Usp13	APN	3	32919060	missense	probably damaging	1.00
IGL02535:Usp13	APN	3	32837926	missense	probably benign	0.43
IGL02863:Usp13	APN	3	32918947	missense	possibly damaging	0.95
IGL03017:Usp13	APN	3	32915712	missense	possibly damaging	0.90
IGL03242:Usp13	APN	3	32902069	missense	probably benign	0.17
PIT4504001:Usp13	UTSW	3	32905430	missense	probably damaging	1.00
R0113:Usp13	UTSW	3	32817876	splice site	probably benign
R0233:Usp13	UTSW	3	32915664	splice site	probably null
R0233:Usp13	UTSW	3	32915664	splice site	probably null
R1241:Usp13	UTSW	3	32915708	missense	probably damaging	1.00
R1765:Usp13	UTSW	3	32915770	missense	probably benign	0.01
R2105:Usp13	UTSW	3	32901986	missense	probably damaging	0.97
R2229:Usp13	UTSW	3	32917551	missense	probably benign	0.02
R2381:Usp13	UTSW	3	32881509	critical splice donor site	probably null
R2389:Usp13	UTSW	3	32905464	missense	probably benign	0.16
R3801:Usp13	UTSW	3	32881508	missense	possibly damaging	0.75
R4062:Usp13	UTSW	3	32881423	missense	probably damaging	1.00
R4653:Usp13	UTSW	3	32837924	missense	probably damaging	0.99
R5123:Usp13	UTSW	3	32915798	missense	probably benign	0.03
R5454:Usp13	UTSW	3	32905436	missense	probably damaging	1.00
R5527:Usp13	UTSW	3	32865838	missense	probably damaging	1.00
R5589:Usp13	UTSW	3	32837858	missense	probably damaging	1.00
R5829:Usp13	UTSW	3	32886523	missense	possibly damaging	0.68
R6114:Usp13	UTSW	3	32854669	missense	probably damaging	1.00
R6625:Usp13	UTSW	3	32894876	missense	probably damaging	0.98
R6680:Usp13	UTSW	3	32881469	missense	probably damaging	0.98
R7175:Usp13	UTSW	3	32917608	nonsense	probably null
R7232:Usp13	UTSW	3	32865871	missense	probably benign	0.05
R7242:Usp13	UTSW	3	32865743	splice site	probably null
R7263:Usp13	UTSW	3	32894851	missense	probably damaging	1.00
R7533:Usp13	UTSW	3	32918942	missense	probably damaging	0.99
R7716:Usp13	UTSW	3	32837856	nonsense	probably null
R7734:Usp13	UTSW	3	32837905	missense	probably benign	0.13
R7943:Usp13	UTSW	3	32876940	missense	probably damaging	1.00
R8075:Usp13	UTSW	3	32931703	missense	probably damaging	1.00
R8141:Usp13	UTSW	3	32894876	missense	possibly damaging	0.52
R8259:Usp13	UTSW	3	32917599	nonsense	probably null
R8722:Usp13	UTSW	3	32901965	missense	probably benign	0.00
R8905:Usp13	UTSW	3	32881423	missense	probably damaging	1.00
R9060:Usp13	UTSW	3	32911663	critical splice donor site	probably null
R9081:Usp13	UTSW	3	32881393	missense	probably benign	0.00
R9260:Usp13	UTSW	3	32901760	intron	probably benign
R9576:Usp13	UTSW	3	32914986	critical splice acceptor site	probably null
X0064:Usp13	UTSW	3	32886589	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CATTTTCTGCGGCAGAGAAGC -3'
(R):5'- TCTGGGTCCAGAGAAACCTG -3'

Sequencing Primer
(F):5'- TGGAGCGAGTGTGCGAGTAC -3'
(R):5'- CCTGGGAGTAACAGAGGAAAC -3'

Posted On

2016-10-26