Incidental Mutation 'R5582:Aldh1b1'
ID438495
Institutional Source Beutler Lab
Gene Symbol Aldh1b1
Ensembl Gene ENSMUSG00000035561
Gene Namealdehyde dehydrogenase 1 family, member B1
Synonyms
MMRRC Submission 043136-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5582 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location45799022-45804604 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 45802750 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 96 (R96L)
Ref Sequence ENSEMBL: ENSMUSP00000134082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044384] [ENSMUST00000172750]
Predicted Effect probably damaging
Transcript: ENSMUST00000044384
AA Change: R96L

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041260
Gene: ENSMUSG00000035561
AA Change: R96L

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Aldedh 47 510 1.5e-185 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172750
AA Change: R96L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134082
Gene: ENSMUSG00000035561
AA Change: R96L

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Aldedh 47 132 1.4e-23 PFAM
Meta Mutation Damage Score 0.4197 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenases family of proteins. Aldehyde dehydrogenase is the second enzyme of the major oxidative pathway of alcohol metabolism. This gene does not contain introns in the coding sequence. The variation of this locus may affect the development of alcohol-related problems. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased fasting circulating glucose levels and decreased blood acetaldehyde clearance. Mice homozygous for a different knock-out allele display defects in beta cell development and functionality, and develop glucose intolerance, age-dependent hyperglycemia, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,636,639 probably null Het
Agxt2 A G 15: 10,399,159 D444G probably damaging Het
Ank2 T C 3: 126,946,305 probably benign Het
Apob A G 12: 8,010,788 Y3090C probably damaging Het
Bbx A G 16: 50,223,356 S647P probably damaging Het
Brinp2 T C 1: 158,249,409 Y372C probably damaging Het
Btaf1 T C 19: 36,988,173 probably null Het
Cdk5rap1 T A 2: 154,345,974 E477D probably benign Het
Cfap65 G A 1: 74,907,518 probably benign Het
Chdh A G 14: 30,036,859 Y587C probably damaging Het
Chek2 T C 5: 110,868,035 V472A probably damaging Het
Clasrp A C 7: 19,586,856 I326S probably damaging Het
Clic6 A T 16: 92,499,454 Q334L possibly damaging Het
Cyp2d11 A T 15: 82,392,118 probably null Het
Entpd7 T C 19: 43,704,994 I171T probably damaging Het
Fosl1 T C 19: 5,455,267 probably benign Het
Gm10130 T C 2: 150,363,052 probably benign Het
Gm6124 A G 7: 39,220,198 noncoding transcript Het
H3f3a A T 1: 180,810,085 probably benign Het
Hs1bp3 AGAGGAGGAGGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGGAGGAGGAGG 12: 8,324,048 probably benign Het
Idh2 CCAGGGC CC 7: 80,098,339 probably null Het
Igkv3-7 A G 6: 70,608,006 Y110C probably damaging Het
Ints9 C T 14: 65,028,896 T399M possibly damaging Het
Kctd19 G A 8: 105,408,443 T62M probably damaging Het
Lsmem1 A G 12: 40,180,644 probably null Het
Obscn T C 11: 59,099,976 probably null Het
Olfr340 T C 2: 36,453,221 I212T probably benign Het
Olfr748 T C 14: 50,710,968 Y213H probably damaging Het
Otop3 T A 11: 115,339,339 M14K unknown Het
Pibf1 C T 14: 99,137,130 A335V possibly damaging Het
Pkd1l2 A T 8: 117,040,783 L1256* probably null Het
Plbd2 T C 5: 120,493,106 E202G probably benign Het
Ppp1r37 A G 7: 19,532,294 S516P probably damaging Het
Ppt2 G A 17: 34,617,399 T229M probably damaging Het
Prr14 A T 7: 127,476,397 I526F probably damaging Het
Scel T C 14: 103,583,139 probably benign Het
Scn9a A T 2: 66,565,029 probably benign Het
Senp6 T A 9: 80,089,876 D57E possibly damaging Het
Setd5 T C 6: 113,114,925 Y217H probably damaging Het
Sgcg T C 14: 61,225,305 T198A probably damaging Het
Sipa1 C T 19: 5,654,701 G622D probably benign Het
Slc27a2 C T 2: 126,564,690 A98V probably damaging Het
Slitrk3 G T 3: 73,050,404 P345Q probably benign Het
Slx4 T C 16: 3,985,788 D1054G possibly damaging Het
Sned1 A T 1: 93,282,361 T898S probably damaging Het
Tg C T 15: 66,693,435 P1209S probably damaging Het
Tmem63b C A 17: 45,667,763 V294L probably benign Het
Tnks G A 8: 34,940,861 R238C probably benign Het
Tsn G A 1: 118,305,214 T120I probably damaging Het
Txnrd1 T A 10: 82,895,980 F479I possibly damaging Het
Ubr1 T C 2: 120,915,407 M849V probably benign Het
Usp13 T C 3: 32,911,589 S574P probably damaging Het
Vmn1r69 A G 7: 10,580,508 Y20H probably damaging Het
Zfp780b T A 7: 27,964,827 N101I probably damaging Het
Other mutations in Aldh1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01731:Aldh1b1 APN 4 45803472 missense possibly damaging 0.87
R0557:Aldh1b1 UTSW 4 45802647 missense probably benign 0.00
R1203:Aldh1b1 UTSW 4 45803359 missense probably damaging 1.00
R1807:Aldh1b1 UTSW 4 45802873 missense possibly damaging 0.69
R1939:Aldh1b1 UTSW 4 45802755 missense possibly damaging 0.53
R4722:Aldh1b1 UTSW 4 45803472 missense probably damaging 1.00
R4847:Aldh1b1 UTSW 4 45802625 missense possibly damaging 0.92
R4871:Aldh1b1 UTSW 4 45803383 missense probably benign 0.00
R4931:Aldh1b1 UTSW 4 45803661 missense probably benign 0.08
R4994:Aldh1b1 UTSW 4 45803128 missense possibly damaging 0.90
R5071:Aldh1b1 UTSW 4 45803383 splice site probably null
R5216:Aldh1b1 UTSW 4 45803652 missense probably damaging 1.00
R6077:Aldh1b1 UTSW 4 45802525 missense possibly damaging 0.92
R6640:Aldh1b1 UTSW 4 45803868 missense possibly damaging 0.92
R6692:Aldh1b1 UTSW 4 45803427 missense probably damaging 1.00
R7055:Aldh1b1 UTSW 4 45802909 missense possibly damaging 0.84
R7935:Aldh1b1 UTSW 4 45802968 missense probably benign 0.13
R7949:Aldh1b1 UTSW 4 45802807 missense possibly damaging 0.53
R7976:Aldh1b1 UTSW 4 45803092 missense possibly damaging 0.92
R8441:Aldh1b1 UTSW 4 45802465 start codon destroyed probably null
R8515:Aldh1b1 UTSW 4 45803818 missense probably damaging 1.00
R8698:Aldh1b1 UTSW 4 45802942 missense probably damaging 1.00
Z1088:Aldh1b1 UTSW 4 45802539 missense probably benign 0.06
Z1088:Aldh1b1 UTSW 4 45802540 missense probably benign 0.11
Z1177:Aldh1b1 UTSW 4 45802692 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTACTCTACAGCAGCTGC -3'
(R):5'- CAGCGAAGTAACGGTACACC -3'

Sequencing Primer
(F):5'- CAGAGATTTGCTACAACAAGCTG -3'
(R):5'- GTAACGGTACACCTTGATGACTTC -3'
Posted On2016-10-26