Incidental Mutation 'R5582:Txnrd1'
ID438513
Institutional Source Beutler Lab
Gene Symbol Txnrd1
Ensembl Gene ENSMUSG00000020250
Gene Namethioredoxin reductase 1
SynonymsTR1, TR, TrxR1, TR alpha
MMRRC Submission 043136-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5582 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location82833951-82897712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82895980 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 479 (F479I)
Ref Sequence ENSEMBL: ENSMUSP00000151825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020484] [ENSMUST00000219368] [ENSMUST00000219442] [ENSMUST00000219962]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020484
AA Change: F479I

PolyPhen 2 Score 0.720 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000020484
Gene: ENSMUSG00000020250
AA Change: F479I

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 13 350 9.7e-69 PFAM
Pfam:FAD_binding_2 14 69 2.6e-8 PFAM
Pfam:Pyr_redox 192 273 1.3e-18 PFAM
Pfam:Pyr_redox_dim 370 483 8.4e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218724
Predicted Effect possibly damaging
Transcript: ENSMUST00000219368
AA Change: F593I

PolyPhen 2 Score 0.720 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219442
AA Change: F479I

PolyPhen 2 Score 0.720 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219962
AA Change: F479I

PolyPhen 2 Score 0.720 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.1699 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: This gene encodes a member of the family of pyridine nucleotide-disulfide oxidoreductases. This protein is a flavoenzyme, which uses NADPH for reduction of thioredoxins as well as other protein and nonprotein substrates, and plays a role in protection against oxidative stress. It contains a selenocysteine (Sec) residue, which is essential for catalytic activity. The selenocysteine is encoded by the UGA codon that normally signals translation termination. The 3' UTR of Sec-containing genes have a common stem-loop structure, the sec insertion sequence (SECIS), that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternative splicing of this gene results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit early embryonic lethality (by E10.5) and display severe growth retardation and fail to turn. Embryos also exhibit decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,636,639 probably null Het
Agxt2 A G 15: 10,399,159 D444G probably damaging Het
Aldh1b1 G T 4: 45,802,750 R96L probably damaging Het
Ank2 T C 3: 126,946,305 probably benign Het
Apob A G 12: 8,010,788 Y3090C probably damaging Het
Bbx A G 16: 50,223,356 S647P probably damaging Het
Brinp2 T C 1: 158,249,409 Y372C probably damaging Het
Btaf1 T C 19: 36,988,173 probably null Het
Cdk5rap1 T A 2: 154,345,974 E477D probably benign Het
Cfap65 G A 1: 74,907,518 probably benign Het
Chdh A G 14: 30,036,859 Y587C probably damaging Het
Chek2 T C 5: 110,868,035 V472A probably damaging Het
Clasrp A C 7: 19,586,856 I326S probably damaging Het
Clic6 A T 16: 92,499,454 Q334L possibly damaging Het
Cyp2d11 A T 15: 82,392,118 probably null Het
Entpd7 T C 19: 43,704,994 I171T probably damaging Het
Fosl1 T C 19: 5,455,267 probably benign Het
Gm10130 T C 2: 150,363,052 probably benign Het
Gm6124 A G 7: 39,220,198 noncoding transcript Het
H3f3a A T 1: 180,810,085 probably benign Het
Hs1bp3 AGAGGAGGAGGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGGAGGAGGAGG 12: 8,324,048 probably benign Het
Idh2 CCAGGGC CC 7: 80,098,339 probably null Het
Igkv3-7 A G 6: 70,608,006 Y110C probably damaging Het
Ints9 C T 14: 65,028,896 T399M possibly damaging Het
Kctd19 G A 8: 105,408,443 T62M probably damaging Het
Lsmem1 A G 12: 40,180,644 probably null Het
Obscn T C 11: 59,099,976 probably null Het
Olfr340 T C 2: 36,453,221 I212T probably benign Het
Olfr748 T C 14: 50,710,968 Y213H probably damaging Het
Otop3 T A 11: 115,339,339 M14K unknown Het
Pibf1 C T 14: 99,137,130 A335V possibly damaging Het
Pkd1l2 A T 8: 117,040,783 L1256* probably null Het
Plbd2 T C 5: 120,493,106 E202G probably benign Het
Ppp1r37 A G 7: 19,532,294 S516P probably damaging Het
Ppt2 G A 17: 34,617,399 T229M probably damaging Het
Prr14 A T 7: 127,476,397 I526F probably damaging Het
Scel T C 14: 103,583,139 probably benign Het
Scn9a A T 2: 66,565,029 probably benign Het
Senp6 T A 9: 80,089,876 D57E possibly damaging Het
Setd5 T C 6: 113,114,925 Y217H probably damaging Het
Sgcg T C 14: 61,225,305 T198A probably damaging Het
Sipa1 C T 19: 5,654,701 G622D probably benign Het
Slc27a2 C T 2: 126,564,690 A98V probably damaging Het
Slitrk3 G T 3: 73,050,404 P345Q probably benign Het
Slx4 T C 16: 3,985,788 D1054G possibly damaging Het
Sned1 A T 1: 93,282,361 T898S probably damaging Het
Tg C T 15: 66,693,435 P1209S probably damaging Het
Tmem63b C A 17: 45,667,763 V294L probably benign Het
Tnks G A 8: 34,940,861 R238C probably benign Het
Tsn G A 1: 118,305,214 T120I probably damaging Het
Ubr1 T C 2: 120,915,407 M849V probably benign Het
Usp13 T C 3: 32,911,589 S574P probably damaging Het
Vmn1r69 A G 7: 10,580,508 Y20H probably damaging Het
Zfp780b T A 7: 27,964,827 N101I probably damaging Het
Other mutations in Txnrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Txnrd1 APN 10 82875662 missense probably damaging 1.00
IGL00644:Txnrd1 APN 10 82885176 splice site probably benign
IGL01995:Txnrd1 APN 10 82877284 missense probably damaging 1.00
IGL02167:Txnrd1 APN 10 82881911 missense probably benign 0.01
IGL02368:Txnrd1 APN 10 82895974 splice site probably null
IGL02500:Txnrd1 APN 10 82879217 missense probably damaging 1.00
IGL02870:Txnrd1 APN 10 82895979 missense probably benign 0.13
IGL03188:Txnrd1 APN 10 82885046 missense possibly damaging 0.79
IGL03257:Txnrd1 APN 10 82885271 missense probably benign 0.00
F6893:Txnrd1 UTSW 10 82866989 nonsense probably null
R0092:Txnrd1 UTSW 10 82879802 missense probably damaging 1.00
R2019:Txnrd1 UTSW 10 82877373 missense probably benign 0.00
R2088:Txnrd1 UTSW 10 82883910 splice site probably benign
R2101:Txnrd1 UTSW 10 82881739 missense probably damaging 1.00
R2120:Txnrd1 UTSW 10 82887233 missense possibly damaging 0.86
R2696:Txnrd1 UTSW 10 82885282 missense probably benign 0.05
R4058:Txnrd1 UTSW 10 82885280 missense probably benign 0.03
R4059:Txnrd1 UTSW 10 82885280 missense probably benign 0.03
R4879:Txnrd1 UTSW 10 82881917 splice site probably null
R6870:Txnrd1 UTSW 10 82873208 missense probably benign 0.45
R6965:Txnrd1 UTSW 10 82881818 missense probably benign 0.02
R7336:Txnrd1 UTSW 10 82873217 missense probably benign 0.00
R7449:Txnrd1 UTSW 10 82885233 nonsense probably null
R8350:Txnrd1 UTSW 10 82881925 missense probably benign 0.02
R8369:Txnrd1 UTSW 10 82874646 missense probably benign 0.01
RF019:Txnrd1 UTSW 10 82885100 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGGTCGACAATGCCCTTAAC -3'
(R):5'- ACAGCACCTTGAATTGGCG -3'

Sequencing Primer
(F):5'- TATTCGCACATATAGGAAGCAGCTC -3'
(R):5'- ACCTTGAATTGGCGCCTAG -3'
Posted On2016-10-26