Incidental Mutation 'R5582:Otop3'
ID 438516
Institutional Source Beutler Lab
Gene Symbol Otop3
Ensembl Gene ENSMUSG00000018862
Gene Name otopetrin 3
Synonyms 2310011E08Rik
MMRRC Submission 043136-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R5582 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 115334731-115346927 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 115339339 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 14 (M14K)
Ref Sequence ENSEMBL: ENSMUSP00000102153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019006] [ENSMUST00000106543]
AlphaFold Q80UF9
Predicted Effect unknown
Transcript: ENSMUST00000019006
AA Change: M14K
SMART Domains Protein: ENSMUSP00000019006
Gene: ENSMUSG00000018862
AA Change: M14K

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 102 120 N/A INTRINSIC
Pfam:Otopetrin 142 483 3e-40 PFAM
Pfam:Otopetrin 506 583 1.2e-14 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000106543
AA Change: M14K
SMART Domains Protein: ENSMUSP00000102153
Gene: ENSMUSG00000018862
AA Change: M14K

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 102 120 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 178 195 N/A INTRINSIC
transmembrane domain 208 227 N/A INTRINSIC
Pfam:Otopetrin 241 462 2.1e-20 PFAM
Pfam:Otopetrin 487 564 2.2e-12 PFAM
Meta Mutation Damage Score 0.0907 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,636,639 probably null Het
Agxt2 A G 15: 10,399,159 D444G probably damaging Het
Aldh1b1 G T 4: 45,802,750 R96L probably damaging Het
Ank2 T C 3: 126,946,305 probably benign Het
Apob A G 12: 8,010,788 Y3090C probably damaging Het
Bbx A G 16: 50,223,356 S647P probably damaging Het
Brinp2 T C 1: 158,249,409 Y372C probably damaging Het
Btaf1 T C 19: 36,988,173 probably null Het
Cdk5rap1 T A 2: 154,345,974 E477D probably benign Het
Cfap65 G A 1: 74,907,518 probably benign Het
Chdh A G 14: 30,036,859 Y587C probably damaging Het
Chek2 T C 5: 110,868,035 V472A probably damaging Het
Clasrp A C 7: 19,586,856 I326S probably damaging Het
Clic6 A T 16: 92,499,454 Q334L possibly damaging Het
Cyp2d11 A T 15: 82,392,118 probably null Het
Entpd7 T C 19: 43,704,994 I171T probably damaging Het
Fosl1 T C 19: 5,455,267 probably benign Het
Gm10130 T C 2: 150,363,052 probably benign Het
Gm6124 A G 7: 39,220,198 noncoding transcript Het
H3f3a A T 1: 180,810,085 probably benign Het
Hs1bp3 AGAGGAGGAGGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGGAGGAGGAGG 12: 8,324,048 probably benign Het
Idh2 CCAGGGC CC 7: 80,098,339 probably null Het
Igkv3-7 A G 6: 70,608,006 Y110C probably damaging Het
Ints9 C T 14: 65,028,896 T399M possibly damaging Het
Kctd19 G A 8: 105,408,443 T62M probably damaging Het
Lsmem1 A G 12: 40,180,644 probably null Het
Obscn T C 11: 59,099,976 probably null Het
Olfr340 T C 2: 36,453,221 I212T probably benign Het
Olfr748 T C 14: 50,710,968 Y213H probably damaging Het
Pibf1 C T 14: 99,137,130 A335V possibly damaging Het
Pkd1l2 A T 8: 117,040,783 L1256* probably null Het
Plbd2 T C 5: 120,493,106 E202G probably benign Het
Ppp1r37 A G 7: 19,532,294 S516P probably damaging Het
Ppt2 G A 17: 34,617,399 T229M probably damaging Het
Prr14 A T 7: 127,476,397 I526F probably damaging Het
Scel T C 14: 103,583,139 probably benign Het
Scn9a A T 2: 66,565,029 probably benign Het
Senp6 T A 9: 80,089,876 D57E possibly damaging Het
Setd5 T C 6: 113,114,925 Y217H probably damaging Het
Sgcg T C 14: 61,225,305 T198A probably damaging Het
Sipa1 C T 19: 5,654,701 G622D probably benign Het
Slc27a2 C T 2: 126,564,690 A98V probably damaging Het
Slitrk3 G T 3: 73,050,404 P345Q probably benign Het
Slx4 T C 16: 3,985,788 D1054G possibly damaging Het
Sned1 A T 1: 93,282,361 T898S probably damaging Het
Tg C T 15: 66,693,435 P1209S probably damaging Het
Tmem63b C A 17: 45,667,763 V294L probably benign Het
Tnks G A 8: 34,940,861 R238C probably benign Het
Tsn G A 1: 118,305,214 T120I probably damaging Het
Txnrd1 T A 10: 82,895,980 F479I possibly damaging Het
Ubr1 T C 2: 120,915,407 M849V probably benign Het
Usp13 T C 3: 32,911,589 S574P probably damaging Het
Vmn1r69 A G 7: 10,580,508 Y20H probably damaging Het
Zfp780b T A 7: 27,964,827 N101I probably damaging Het
Other mutations in Otop3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Otop3 APN 11 115344453 missense probably benign
IGL00159:Otop3 APN 11 115344397 missense probably damaging 1.00
IGL01372:Otop3 APN 11 115345104 missense possibly damaging 0.86
IGL01380:Otop3 APN 11 115346411 missense probably damaging 1.00
IGL01960:Otop3 APN 11 115340969 missense probably damaging 0.97
IGL03099:Otop3 APN 11 115339582 missense probably damaging 0.99
F5770:Otop3 UTSW 11 115344838 missense probably damaging 1.00
R1560:Otop3 UTSW 11 115344463 missense possibly damaging 0.89
R2847:Otop3 UTSW 11 115344558 missense probably damaging 0.99
R2849:Otop3 UTSW 11 115344558 missense probably damaging 0.99
R6383:Otop3 UTSW 11 115345072 missense probably damaging 0.99
R6601:Otop3 UTSW 11 115339847 missense probably damaging 0.98
R7001:Otop3 UTSW 11 115339653 missense probably damaging 1.00
R7339:Otop3 UTSW 11 115346378 missense probably damaging 1.00
R7487:Otop3 UTSW 11 115345000 missense probably benign
R7609:Otop3 UTSW 11 115339720 missense possibly damaging 0.63
R7639:Otop3 UTSW 11 115344361 missense possibly damaging 0.94
R7643:Otop3 UTSW 11 115339648 missense probably damaging 1.00
R7820:Otop3 UTSW 11 115339588 missense probably damaging 0.99
R8044:Otop3 UTSW 11 115346435 missense probably damaging 1.00
R8110:Otop3 UTSW 11 115339395 missense probably benign
R8281:Otop3 UTSW 11 115345075 missense possibly damaging 0.88
R8556:Otop3 UTSW 11 115344956 missense probably benign 0.00
R8899:Otop3 UTSW 11 115341060 critical splice donor site probably null
R9137:Otop3 UTSW 11 115345042 missense possibly damaging 0.88
R9165:Otop3 UTSW 11 115344598 missense possibly damaging 0.62
R9306:Otop3 UTSW 11 115346422 missense probably benign 0.09
R9788:Otop3 UTSW 11 115344261 missense unknown
V7580:Otop3 UTSW 11 115344838 missense probably damaging 1.00
V7581:Otop3 UTSW 11 115344838 missense probably damaging 1.00
V7582:Otop3 UTSW 11 115344838 missense probably damaging 1.00
V7583:Otop3 UTSW 11 115344838 missense probably damaging 1.00
X0022:Otop3 UTSW 11 115339867 missense probably benign 0.01
Z1176:Otop3 UTSW 11 115339844 missense probably damaging 1.00
Z1176:Otop3 UTSW 11 115341012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTTTGTGTTCATGGGCAGC -3'
(R):5'- ACCACATTGAGAGCCAGGAG -3'

Sequencing Primer
(F):5'- CAGCAGGAGGGACTTTTGTATATC -3'
(R):5'- AGCCCGGAGAAGAGCTGC -3'
Posted On 2016-10-26