Incidental Mutation 'R5582:Scel'
ID438525
Institutional Source Beutler Lab
Gene Symbol Scel
Ensembl Gene ENSMUSG00000022123
Gene Namesciellin
Synonyms9230114I02Rik
MMRRC Submission 043136-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5582 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location103513342-103612797 bp(+) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) T to C at 103583139 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]
Predicted Effect probably benign
Transcript: ENSMUST00000095576
SMART Domains Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123

DomainStartEndE-ValueType
low complexity region 111 131 N/A INTRINSIC
low complexity region 159 178 N/A INTRINSIC
internal_repeat_1 204 327 9.24e-7 PROSPERO
internal_repeat_1 378 505 9.24e-7 PROSPERO
low complexity region 525 537 N/A INTRINSIC
LIM 584 642 2.23e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227322
Meta Mutation Damage Score 0.0660 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,636,639 probably null Het
Agxt2 A G 15: 10,399,159 D444G probably damaging Het
Aldh1b1 G T 4: 45,802,750 R96L probably damaging Het
Ank2 T C 3: 126,946,305 probably benign Het
Apob A G 12: 8,010,788 Y3090C probably damaging Het
Bbx A G 16: 50,223,356 S647P probably damaging Het
Brinp2 T C 1: 158,249,409 Y372C probably damaging Het
Btaf1 T C 19: 36,988,173 probably null Het
Cdk5rap1 T A 2: 154,345,974 E477D probably benign Het
Cfap65 G A 1: 74,907,518 probably benign Het
Chdh A G 14: 30,036,859 Y587C probably damaging Het
Chek2 T C 5: 110,868,035 V472A probably damaging Het
Clasrp A C 7: 19,586,856 I326S probably damaging Het
Clic6 A T 16: 92,499,454 Q334L possibly damaging Het
Cyp2d11 A T 15: 82,392,118 probably null Het
Entpd7 T C 19: 43,704,994 I171T probably damaging Het
Fosl1 T C 19: 5,455,267 probably benign Het
Gm10130 T C 2: 150,363,052 probably benign Het
Gm6124 A G 7: 39,220,198 noncoding transcript Het
H3f3a A T 1: 180,810,085 probably benign Het
Hs1bp3 AGAGGAGGAGGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGGAGGAGGAGG 12: 8,324,048 probably benign Het
Idh2 CCAGGGC CC 7: 80,098,339 probably null Het
Igkv3-7 A G 6: 70,608,006 Y110C probably damaging Het
Ints9 C T 14: 65,028,896 T399M possibly damaging Het
Kctd19 G A 8: 105,408,443 T62M probably damaging Het
Lsmem1 A G 12: 40,180,644 probably null Het
Obscn T C 11: 59,099,976 probably null Het
Olfr340 T C 2: 36,453,221 I212T probably benign Het
Olfr748 T C 14: 50,710,968 Y213H probably damaging Het
Otop3 T A 11: 115,339,339 M14K unknown Het
Pibf1 C T 14: 99,137,130 A335V possibly damaging Het
Pkd1l2 A T 8: 117,040,783 L1256* probably null Het
Plbd2 T C 5: 120,493,106 E202G probably benign Het
Ppp1r37 A G 7: 19,532,294 S516P probably damaging Het
Ppt2 G A 17: 34,617,399 T229M probably damaging Het
Prr14 A T 7: 127,476,397 I526F probably damaging Het
Scn9a A T 2: 66,565,029 probably benign Het
Senp6 T A 9: 80,089,876 D57E possibly damaging Het
Setd5 T C 6: 113,114,925 Y217H probably damaging Het
Sgcg T C 14: 61,225,305 T198A probably damaging Het
Sipa1 C T 19: 5,654,701 G622D probably benign Het
Slc27a2 C T 2: 126,564,690 A98V probably damaging Het
Slitrk3 G T 3: 73,050,404 P345Q probably benign Het
Slx4 T C 16: 3,985,788 D1054G possibly damaging Het
Sned1 A T 1: 93,282,361 T898S probably damaging Het
Tg C T 15: 66,693,435 P1209S probably damaging Het
Tmem63b C A 17: 45,667,763 V294L probably benign Het
Tnks G A 8: 34,940,861 R238C probably benign Het
Tsn G A 1: 118,305,214 T120I probably damaging Het
Txnrd1 T A 10: 82,895,980 F479I possibly damaging Het
Ubr1 T C 2: 120,915,407 M849V probably benign Het
Usp13 T C 3: 32,911,589 S574P probably damaging Het
Vmn1r69 A G 7: 10,580,508 Y20H probably damaging Het
Zfp780b T A 7: 27,964,827 N101I probably damaging Het
Other mutations in Scel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Scel APN 14 103529995 missense probably benign 0.01
IGL00913:Scel APN 14 103581809 missense probably benign 0.35
IGL01086:Scel APN 14 103612391 missense probably benign 0.05
IGL01352:Scel APN 14 103533338 missense possibly damaging 0.54
IGL01396:Scel APN 14 103608094 splice site probably benign
IGL01954:Scel APN 14 103603242 splice site probably benign
IGL02064:Scel APN 14 103533326 missense probably damaging 0.98
IGL02186:Scel APN 14 103564821 missense probably benign 0.23
IGL02475:Scel APN 14 103537008 missense possibly damaging 0.95
IGL02926:Scel APN 14 103576247 nonsense probably null
IGL03122:Scel APN 14 103599406 missense possibly damaging 0.66
IGL03135:Scel APN 14 103586514 missense probably benign 0.02
PIT4585001:Scel UTSW 14 103592368 missense possibly damaging 0.90
R0346:Scel UTSW 14 103529984 missense probably damaging 1.00
R0394:Scel UTSW 14 103562518 missense probably benign 0.15
R0418:Scel UTSW 14 103603254 missense probably benign
R0635:Scel UTSW 14 103583139 critical splice donor site probably null
R0815:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0863:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0990:Scel UTSW 14 103581832 missense possibly damaging 0.55
R1084:Scel UTSW 14 103564843 critical splice donor site probably null
R1641:Scel UTSW 14 103533316 missense probably damaging 1.00
R2001:Scel UTSW 14 103610790 missense possibly damaging 0.66
R2002:Scel UTSW 14 103541985 missense probably damaging 1.00
R2341:Scel UTSW 14 103608170 missense possibly damaging 0.92
R3425:Scel UTSW 14 103608106 missense possibly damaging 0.92
R3836:Scel UTSW 14 103592386 missense possibly damaging 0.66
R4035:Scel UTSW 14 103530004 missense probably damaging 1.00
R4197:Scel UTSW 14 103599400 missense probably damaging 0.97
R4737:Scel UTSW 14 103572037 missense possibly damaging 0.79
R4801:Scel UTSW 14 103583100 missense probably benign 0.01
R4802:Scel UTSW 14 103583100 missense probably benign 0.01
R5369:Scel UTSW 14 103586493 missense probably benign 0.00
R5555:Scel UTSW 14 103602206 missense probably benign 0.27
R5931:Scel UTSW 14 103605624 nonsense probably null
R5978:Scel UTSW 14 103529254 splice site probably null
R6045:Scel UTSW 14 103592213 missense probably benign 0.12
R6062:Scel UTSW 14 103585136 missense possibly damaging 0.82
R6218:Scel UTSW 14 103572042 missense probably benign 0.12
R6225:Scel UTSW 14 103591984 missense probably benign 0.27
R7102:Scel UTSW 14 103543832 nonsense probably null
R7349:Scel UTSW 14 103543879 missense probably benign 0.11
R8376:Scel UTSW 14 103572015 missense probably benign 0.02
X0026:Scel UTSW 14 103591993 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TCATTGGACACCAGTTCCAG -3'
(R):5'- TGTCTCCACCACAGTCCATACG -3'

Sequencing Primer
(F):5'- TTGGACACCAGTTCCAGAATCAATTC -3'
(R):5'- GTCCATACGCAGGAAGCC -3'
Posted On2016-10-26