Mutagenetix > Incidental Mutations

Incidental Mutation 'R5582:Scel'

438525

Institutional Source

Beutler Lab

Gene Symbol

Scel

Ensembl Gene

ENSMUSG00000022123

Gene Name

sciellin

Synonyms

9230114I02Rik

MMRRC Submission

043136-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5582 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103513342-103612797 bp(+) (GRCm38)

Type of Mutation

critical splice donor site

DNA Base Change (assembly)

T to C at 103583139 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000154402 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]

Predicted Effect

probably benign
Transcript: ENSMUST00000095576

SMART Domains

Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123

Domain	Start	End	E-Value	Type
low complexity region	111	131	N/A	INTRINSIC
low complexity region	159	178	N/A	INTRINSIC
internal_repeat_1	204	327	9.24e-7	PROSPERO
internal_repeat_1	378	505	9.24e-7	PROSPERO
low complexity region	525	537	N/A	INTRINSIC
LIM	584	642	2.23e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000227322

Meta Mutation Damage Score

0.0660

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.6%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	C	11: 9,636,639		probably null	Het
Agxt2	A	G	15: 10,399,159	D444G	probably damaging	Het
Aldh1b1	G	T	4: 45,802,750	R96L	probably damaging	Het
Ank2	T	C	3: 126,946,305		probably benign	Het
Apob	A	G	12: 8,010,788	Y3090C	probably damaging	Het
Bbx	A	G	16: 50,223,356	S647P	probably damaging	Het
Brinp2	T	C	1: 158,249,409	Y372C	probably damaging	Het
Btaf1	T	C	19: 36,988,173		probably null	Het
Cdk5rap1	T	A	2: 154,345,974	E477D	probably benign	Het
Cfap65	G	A	1: 74,907,518		probably benign	Het
Chdh	A	G	14: 30,036,859	Y587C	probably damaging	Het
Chek2	T	C	5: 110,868,035	V472A	probably damaging	Het
Clasrp	A	C	7: 19,586,856	I326S	probably damaging	Het
Clic6	A	T	16: 92,499,454	Q334L	possibly damaging	Het
Cyp2d11	A	T	15: 82,392,118		probably null	Het
Entpd7	T	C	19: 43,704,994	I171T	probably damaging	Het
Fosl1	T	C	19: 5,455,267		probably benign	Het
Gm10130	T	C	2: 150,363,052		probably benign	Het
Gm6124	A	G	7: 39,220,198		noncoding transcript	Het
H3f3a	A	T	1: 180,810,085		probably benign	Het
Hs1bp3	AGAGGAGGAGGAGGAGGAGGAGGAGGAGG	AGAGGAGGAGGAGGAGGAGGAGGAGG	12: 8,324,048		probably benign	Het
Idh2	CCAGGGC	CC	7: 80,098,339		probably null	Het
Igkv3-7	A	G	6: 70,608,006	Y110C	probably damaging	Het
Ints9	C	T	14: 65,028,896	T399M	possibly damaging	Het
Kctd19	G	A	8: 105,408,443	T62M	probably damaging	Het
Lsmem1	A	G	12: 40,180,644		probably null	Het
Obscn	T	C	11: 59,099,976		probably null	Het
Olfr340	T	C	2: 36,453,221	I212T	probably benign	Het
Olfr748	T	C	14: 50,710,968	Y213H	probably damaging	Het
Otop3	T	A	11: 115,339,339	M14K	unknown	Het
Pibf1	C	T	14: 99,137,130	A335V	possibly damaging	Het
Pkd1l2	A	T	8: 117,040,783	L1256*	probably null	Het
Plbd2	T	C	5: 120,493,106	E202G	probably benign	Het
Ppp1r37	A	G	7: 19,532,294	S516P	probably damaging	Het
Ppt2	G	A	17: 34,617,399	T229M	probably damaging	Het
Prr14	A	T	7: 127,476,397	I526F	probably damaging	Het
Scn9a	A	T	2: 66,565,029		probably benign	Het
Senp6	T	A	9: 80,089,876	D57E	possibly damaging	Het
Setd5	T	C	6: 113,114,925	Y217H	probably damaging	Het
Sgcg	T	C	14: 61,225,305	T198A	probably damaging	Het
Sipa1	C	T	19: 5,654,701	G622D	probably benign	Het
Slc27a2	C	T	2: 126,564,690	A98V	probably damaging	Het
Slitrk3	G	T	3: 73,050,404	P345Q	probably benign	Het
Slx4	T	C	16: 3,985,788	D1054G	possibly damaging	Het
Sned1	A	T	1: 93,282,361	T898S	probably damaging	Het
Tg	C	T	15: 66,693,435	P1209S	probably damaging	Het
Tmem63b	C	A	17: 45,667,763	V294L	probably benign	Het
Tnks	G	A	8: 34,940,861	R238C	probably benign	Het
Tsn	G	A	1: 118,305,214	T120I	probably damaging	Het
Txnrd1	T	A	10: 82,895,980	F479I	possibly damaging	Het
Ubr1	T	C	2: 120,915,407	M849V	probably benign	Het
Usp13	T	C	3: 32,911,589	S574P	probably damaging	Het
Vmn1r69	A	G	7: 10,580,508	Y20H	probably damaging	Het
Zfp780b	T	A	7: 27,964,827	N101I	probably damaging	Het

Other mutations in Scel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Scel	APN	14	103529995	missense	probably benign	0.01
IGL00913:Scel	APN	14	103581809	missense	probably benign	0.35
IGL01086:Scel	APN	14	103612391	missense	probably benign	0.05
IGL01352:Scel	APN	14	103533338	missense	possibly damaging	0.54
IGL01396:Scel	APN	14	103608094	splice site	probably benign
IGL01954:Scel	APN	14	103603242	splice site	probably benign
IGL02064:Scel	APN	14	103533326	missense	probably damaging	0.98
IGL02186:Scel	APN	14	103564821	missense	probably benign	0.23
IGL02475:Scel	APN	14	103537008	missense	possibly damaging	0.95
IGL02926:Scel	APN	14	103576247	nonsense	probably null
IGL03122:Scel	APN	14	103599406	missense	possibly damaging	0.66
IGL03135:Scel	APN	14	103586514	missense	probably benign	0.02
PIT4585001:Scel	UTSW	14	103592368	missense	possibly damaging	0.90
R0346:Scel	UTSW	14	103529984	missense	probably damaging	1.00
R0394:Scel	UTSW	14	103562518	missense	probably benign	0.15
R0418:Scel	UTSW	14	103603254	missense	probably benign
R0635:Scel	UTSW	14	103583139	critical splice donor site	probably null
R0815:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0863:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0990:Scel	UTSW	14	103581832	missense	possibly damaging	0.55
R1084:Scel	UTSW	14	103564843	critical splice donor site	probably null
R1641:Scel	UTSW	14	103533316	missense	probably damaging	1.00
R2001:Scel	UTSW	14	103610790	missense	possibly damaging	0.66
R2002:Scel	UTSW	14	103541985	missense	probably damaging	1.00
R2341:Scel	UTSW	14	103608170	missense	possibly damaging	0.92
R3425:Scel	UTSW	14	103608106	missense	possibly damaging	0.92
R3836:Scel	UTSW	14	103592386	missense	possibly damaging	0.66
R4035:Scel	UTSW	14	103530004	missense	probably damaging	1.00
R4197:Scel	UTSW	14	103599400	missense	probably damaging	0.97
R4737:Scel	UTSW	14	103572037	missense	possibly damaging	0.79
R4801:Scel	UTSW	14	103583100	missense	probably benign	0.01
R4802:Scel	UTSW	14	103583100	missense	probably benign	0.01
R5369:Scel	UTSW	14	103586493	missense	probably benign	0.00
R5555:Scel	UTSW	14	103602206	missense	probably benign	0.27
R5931:Scel	UTSW	14	103605624	nonsense	probably null
R5978:Scel	UTSW	14	103529254	splice site	probably null
R6045:Scel	UTSW	14	103592213	missense	probably benign	0.12
R6062:Scel	UTSW	14	103585136	missense	possibly damaging	0.82
R6218:Scel	UTSW	14	103572042	missense	probably benign	0.12
R6225:Scel	UTSW	14	103591984	missense	probably benign	0.27
R7102:Scel	UTSW	14	103543832	nonsense	probably null
R7349:Scel	UTSW	14	103543879	missense	probably benign	0.11
R8376:Scel	UTSW	14	103572015	missense	probably benign	0.02
X0026:Scel	UTSW	14	103591993	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- TCATTGGACACCAGTTCCAG -3'
(R):5'- TGTCTCCACCACAGTCCATACG -3'

Sequencing Primer
(F):5'- TTGGACACCAGTTCCAGAATCAATTC -3'
(R):5'- GTCCATACGCAGGAAGCC -3'

Posted On

2016-10-26