Incidental Mutation 'R5582:Agxt2'
ID438526
Institutional Source Beutler Lab
Gene Symbol Agxt2
Ensembl Gene ENSMUSG00000089678
Gene Namealanine-glyoxylate aminotransferase 2
Synonyms
MMRRC Submission 043136-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5582 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location10358532-10410153 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10399159 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 444 (D444G)
Ref Sequence ENSEMBL: ENSMUSP00000106171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022858] [ENSMUST00000110542]
Predicted Effect probably damaging
Transcript: ENSMUST00000022858
AA Change: D472G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022858
Gene: ENSMUSG00000089678
AA Change: D472G

DomainStartEndE-ValueType
Pfam:Aminotran_3 76 228 4.5e-36 PFAM
Pfam:Aminotran_3 269 532 5.7e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110542
AA Change: D444G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106171
Gene: ENSMUSG00000089678
AA Change: D444G

DomainStartEndE-ValueType
Pfam:Aminotran_3 87 443 1.3e-88 PFAM
Meta Mutation Damage Score 0.5308 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a class III pyridoxal-phosphate-dependent mitochondrial aminotransferase. It catalyzes the conversion of glyoxylate to glycine using L-alanine as the amino donor. It is an important regulator of methylarginines and is involved in the control of blood pressure in kidney. Polymorphisms in this gene affect methylarginine and beta-aminoisobutyrate metabolism, and are associated with carotid atherosclerosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit reduced circulating L-citrulline, hypertension under terminal aesthesia and increased vasodilation maximal response following acetylcholine treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,636,639 probably null Het
Aldh1b1 G T 4: 45,802,750 R96L probably damaging Het
Ank2 T C 3: 126,946,305 probably benign Het
Apob A G 12: 8,010,788 Y3090C probably damaging Het
Bbx A G 16: 50,223,356 S647P probably damaging Het
Brinp2 T C 1: 158,249,409 Y372C probably damaging Het
Btaf1 T C 19: 36,988,173 probably null Het
Cdk5rap1 T A 2: 154,345,974 E477D probably benign Het
Cfap65 G A 1: 74,907,518 probably benign Het
Chdh A G 14: 30,036,859 Y587C probably damaging Het
Chek2 T C 5: 110,868,035 V472A probably damaging Het
Clasrp A C 7: 19,586,856 I326S probably damaging Het
Clic6 A T 16: 92,499,454 Q334L possibly damaging Het
Cyp2d11 A T 15: 82,392,118 probably null Het
Entpd7 T C 19: 43,704,994 I171T probably damaging Het
Fosl1 T C 19: 5,455,267 probably benign Het
Gm10130 T C 2: 150,363,052 probably benign Het
Gm6124 A G 7: 39,220,198 noncoding transcript Het
H3f3a A T 1: 180,810,085 probably benign Het
Hs1bp3 AGAGGAGGAGGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGGAGGAGGAGG 12: 8,324,048 probably benign Het
Idh2 CCAGGGC CC 7: 80,098,339 probably null Het
Igkv3-7 A G 6: 70,608,006 Y110C probably damaging Het
Ints9 C T 14: 65,028,896 T399M possibly damaging Het
Kctd19 G A 8: 105,408,443 T62M probably damaging Het
Lsmem1 A G 12: 40,180,644 probably null Het
Obscn T C 11: 59,099,976 probably null Het
Olfr340 T C 2: 36,453,221 I212T probably benign Het
Olfr748 T C 14: 50,710,968 Y213H probably damaging Het
Otop3 T A 11: 115,339,339 M14K unknown Het
Pibf1 C T 14: 99,137,130 A335V possibly damaging Het
Pkd1l2 A T 8: 117,040,783 L1256* probably null Het
Plbd2 T C 5: 120,493,106 E202G probably benign Het
Ppp1r37 A G 7: 19,532,294 S516P probably damaging Het
Ppt2 G A 17: 34,617,399 T229M probably damaging Het
Prr14 A T 7: 127,476,397 I526F probably damaging Het
Scel T C 14: 103,583,139 probably benign Het
Scn9a A T 2: 66,565,029 probably benign Het
Senp6 T A 9: 80,089,876 D57E possibly damaging Het
Setd5 T C 6: 113,114,925 Y217H probably damaging Het
Sgcg T C 14: 61,225,305 T198A probably damaging Het
Sipa1 C T 19: 5,654,701 G622D probably benign Het
Slc27a2 C T 2: 126,564,690 A98V probably damaging Het
Slitrk3 G T 3: 73,050,404 P345Q probably benign Het
Slx4 T C 16: 3,985,788 D1054G possibly damaging Het
Sned1 A T 1: 93,282,361 T898S probably damaging Het
Tg C T 15: 66,693,435 P1209S probably damaging Het
Tmem63b C A 17: 45,667,763 V294L probably benign Het
Tnks G A 8: 34,940,861 R238C probably benign Het
Tsn G A 1: 118,305,214 T120I probably damaging Het
Txnrd1 T A 10: 82,895,980 F479I possibly damaging Het
Ubr1 T C 2: 120,915,407 M849V probably benign Het
Usp13 T C 3: 32,911,589 S574P probably damaging Het
Vmn1r69 A G 7: 10,580,508 Y20H probably damaging Het
Zfp780b T A 7: 27,964,827 N101I probably damaging Het
Other mutations in Agxt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01958:Agxt2 APN 15 10393708 splice site probably null
IGL02434:Agxt2 APN 15 10358600 missense possibly damaging 0.83
IGL02824:Agxt2 APN 15 10393805 missense probably null 0.96
IGL02929:Agxt2 APN 15 10388293 splice site probably benign
IGL03368:Agxt2 APN 15 10388170 nonsense probably null
PIT4810001:Agxt2 UTSW 15 10399065 missense probably benign 0.00
R0179:Agxt2 UTSW 15 10399048 missense possibly damaging 0.71
R0526:Agxt2 UTSW 15 10373862 missense probably damaging 1.00
R1085:Agxt2 UTSW 15 10388252 missense probably benign 0.00
R1173:Agxt2 UTSW 15 10373751 missense probably damaging 1.00
R1174:Agxt2 UTSW 15 10373751 missense probably damaging 1.00
R1387:Agxt2 UTSW 15 10380610 missense probably damaging 1.00
R1642:Agxt2 UTSW 15 10373831 missense probably damaging 1.00
R1938:Agxt2 UTSW 15 10391935 missense probably damaging 1.00
R3439:Agxt2 UTSW 15 10381425 missense probably benign 0.19
R4485:Agxt2 UTSW 15 10378882 missense possibly damaging 0.89
R4698:Agxt2 UTSW 15 10392044 critical splice donor site probably null
R6056:Agxt2 UTSW 15 10378877 missense probably damaging 1.00
R6109:Agxt2 UTSW 15 10377422 missense probably damaging 1.00
R6393:Agxt2 UTSW 15 10393808 critical splice donor site probably null
R6868:Agxt2 UTSW 15 10373769 missense probably damaging 1.00
R7206:Agxt2 UTSW 15 10377456 missense probably damaging 0.99
R7275:Agxt2 UTSW 15 10358667 missense probably benign 0.00
R7475:Agxt2 UTSW 15 10409537 missense probably benign
R7792:Agxt2 UTSW 15 10381386 missense probably damaging 1.00
R8722:Agxt2 UTSW 15 10373739 missense probably benign
R8899:Agxt2 UTSW 15 10378814 missense probably damaging 1.00
R8929:Agxt2 UTSW 15 10393744 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TATGTAGGGGCTGTCTCTCCAC -3'
(R):5'- TGACTAAACCTCAATCCTGCTCAG -3'

Sequencing Primer
(F):5'- TCTCTCCACAGGTGATTGAAG -3'
(R):5'- AGAGCTCTTCTCAGTACACTTGG -3'
Posted On2016-10-26