Incidental Mutation 'R5582:Clic6'
ID438532
Institutional Source Beutler Lab
Gene Symbol Clic6
Ensembl Gene ENSMUSG00000022949
Gene Namechloride intracellular channel 6
SynonymsCLIC1L, 5730466J16Rik
MMRRC Submission 043136-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R5582 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location92485736-92541243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92499454 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 334 (Q334L)
Ref Sequence ENSEMBL: ENSMUSP00000023670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023670] [ENSMUST00000162181]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023670
AA Change: Q334L

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023670
Gene: ENSMUSG00000022949
AA Change: Q334L

DomainStartEndE-ValueType
low complexity region 38 46 N/A INTRINSIC
low complexity region 62 74 N/A INTRINSIC
low complexity region 83 108 N/A INTRINSIC
low complexity region 151 169 N/A INTRINSIC
low complexity region 193 213 N/A INTRINSIC
low complexity region 225 245 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
low complexity region 308 318 N/A INTRINSIC
Pfam:GST_N_3 375 447 2e-9 PFAM
Pfam:GST_C_2 478 567 1.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160494
SMART Domains Protein: ENSMUSP00000123968
Gene: ENSMUSG00000051297

DomainStartEndE-ValueType
low complexity region 4 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162181
SMART Domains Protein: ENSMUSP00000124498
Gene: ENSMUSG00000022949

DomainStartEndE-ValueType
Pfam:GST_N_3 34 100 2.8e-10 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chloride intracellular channel family of proteins. The gene is part of a large triplicated region found on chromosomes 1, 6, and 21. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,636,639 probably null Het
Agxt2 A G 15: 10,399,159 D444G probably damaging Het
Aldh1b1 G T 4: 45,802,750 R96L probably damaging Het
Ank2 T C 3: 126,946,305 probably benign Het
Apob A G 12: 8,010,788 Y3090C probably damaging Het
Bbx A G 16: 50,223,356 S647P probably damaging Het
Brinp2 T C 1: 158,249,409 Y372C probably damaging Het
Btaf1 T C 19: 36,988,173 probably null Het
Cdk5rap1 T A 2: 154,345,974 E477D probably benign Het
Cfap65 G A 1: 74,907,518 probably benign Het
Chdh A G 14: 30,036,859 Y587C probably damaging Het
Chek2 T C 5: 110,868,035 V472A probably damaging Het
Clasrp A C 7: 19,586,856 I326S probably damaging Het
Cyp2d11 A T 15: 82,392,118 probably null Het
Entpd7 T C 19: 43,704,994 I171T probably damaging Het
Fosl1 T C 19: 5,455,267 probably benign Het
Gm10130 T C 2: 150,363,052 probably benign Het
Gm6124 A G 7: 39,220,198 noncoding transcript Het
H3f3a A T 1: 180,810,085 probably benign Het
Hs1bp3 AGAGGAGGAGGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGGAGGAGGAGG 12: 8,324,048 probably benign Het
Idh2 CCAGGGC CC 7: 80,098,339 probably null Het
Igkv3-7 A G 6: 70,608,006 Y110C probably damaging Het
Ints9 C T 14: 65,028,896 T399M possibly damaging Het
Kctd19 G A 8: 105,408,443 T62M probably damaging Het
Lsmem1 A G 12: 40,180,644 probably null Het
Obscn T C 11: 59,099,976 probably null Het
Olfr340 T C 2: 36,453,221 I212T probably benign Het
Olfr748 T C 14: 50,710,968 Y213H probably damaging Het
Otop3 T A 11: 115,339,339 M14K unknown Het
Pibf1 C T 14: 99,137,130 A335V possibly damaging Het
Pkd1l2 A T 8: 117,040,783 L1256* probably null Het
Plbd2 T C 5: 120,493,106 E202G probably benign Het
Ppp1r37 A G 7: 19,532,294 S516P probably damaging Het
Ppt2 G A 17: 34,617,399 T229M probably damaging Het
Prr14 A T 7: 127,476,397 I526F probably damaging Het
Scel T C 14: 103,583,139 probably benign Het
Scn9a A T 2: 66,565,029 probably benign Het
Senp6 T A 9: 80,089,876 D57E possibly damaging Het
Setd5 T C 6: 113,114,925 Y217H probably damaging Het
Sgcg T C 14: 61,225,305 T198A probably damaging Het
Sipa1 C T 19: 5,654,701 G622D probably benign Het
Slc27a2 C T 2: 126,564,690 A98V probably damaging Het
Slitrk3 G T 3: 73,050,404 P345Q probably benign Het
Slx4 T C 16: 3,985,788 D1054G possibly damaging Het
Sned1 A T 1: 93,282,361 T898S probably damaging Het
Tg C T 15: 66,693,435 P1209S probably damaging Het
Tmem63b C A 17: 45,667,763 V294L probably benign Het
Tnks G A 8: 34,940,861 R238C probably benign Het
Tsn G A 1: 118,305,214 T120I probably damaging Het
Txnrd1 T A 10: 82,895,980 F479I possibly damaging Het
Ubr1 T C 2: 120,915,407 M849V probably benign Het
Usp13 T C 3: 32,911,589 S574P probably damaging Het
Vmn1r69 A G 7: 10,580,508 Y20H probably damaging Het
Zfp780b T A 7: 27,964,827 N101I probably damaging Het
Other mutations in Clic6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Clic6 APN 16 92499308 missense probably damaging 0.99
IGL02104:Clic6 APN 16 92498479 missense possibly damaging 0.72
IGL02387:Clic6 APN 16 92529919 missense probably damaging 1.00
IGL02437:Clic6 APN 16 92530929 missense probably damaging 1.00
IGL02617:Clic6 APN 16 92499318 missense probably benign 0.00
unsweetened UTSW 16 92530809 missense possibly damaging 0.79
R1544:Clic6 UTSW 16 92492073 intron probably benign
R1677:Clic6 UTSW 16 92528084 missense probably damaging 1.00
R2149:Clic6 UTSW 16 92499207 missense probably benign 0.00
R3965:Clic6 UTSW 16 92498844 missense probably benign 0.00
R4171:Clic6 UTSW 16 92497061 intron probably benign
R4545:Clic6 UTSW 16 92492157 intron probably benign
R4637:Clic6 UTSW 16 92497061 intron probably benign
R4649:Clic6 UTSW 16 92530939 critical splice donor site probably null
R5159:Clic6 UTSW 16 92528066 missense probably benign 0.13
R5249:Clic6 UTSW 16 92539451 missense probably damaging 1.00
R5486:Clic6 UTSW 16 92529852 intron probably null
R6140:Clic6 UTSW 16 92539492 missense probably damaging 1.00
R6234:Clic6 UTSW 16 92499222 missense probably benign
R6379:Clic6 UTSW 16 92539535 missense probably damaging 1.00
R6593:Clic6 UTSW 16 92528117 missense possibly damaging 0.82
R7890:Clic6 UTSW 16 92499387 missense probably benign 0.41
RF012:Clic6 UTSW 16 92530809 missense possibly damaging 0.79
X0058:Clic6 UTSW 16 92498707 missense probably benign
Z1176:Clic6 UTSW 16 92498895 missense probably benign 0.26
Z1177:Clic6 UTSW 16 92499139 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GGATGCGAGAGTAGATGCTC -3'
(R):5'- TCCTTCTGACTGATTGAAGCAC -3'

Sequencing Primer
(F):5'- TGCGAGAGTAGATGCTCATGAG -3'
(R):5'- CTGACTGATTGAAGCACTTGAGTACG -3'
Posted On2016-10-26