Incidental Mutation 'R5582:Btaf1'
ID438537
Institutional Source Beutler Lab
Gene Symbol Btaf1
Ensembl Gene ENSMUSG00000040565
Gene NameB-TFIID TATA-box binding protein associated factor 1
SynonymsE430027O22Rik
MMRRC Submission 043136-MU
Accession Numbers

Genbank: NM_001080706

Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R5582 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location36926079-37012752 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 36988173 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099494]
Predicted Effect probably null
Transcript: ENSMUST00000099494
SMART Domains Protein: ENSMUSP00000097093
Gene: ENSMUSG00000040565

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
low complexity region 143 152 N/A INTRINSIC
PDB:3OC3|B 276 414 3e-6 PDB
low complexity region 438 454 N/A INTRINSIC
Pfam:DUF3535 585 1051 1.1e-133 PFAM
low complexity region 1099 1110 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
DEXDc 1261 1469 3.02e-30 SMART
low complexity region 1630 1641 N/A INTRINSIC
HELICc 1657 1743 2.22e-19 SMART
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TAF (TATA box-binding protein-associated factor), which associates with TBP (TATA box-binding protein) to form the B-TFIID complex that is required for transcription initiation of genes by RNA polymerase II. This TAF has DNA-dependent ATPase activity, which drives the dissociation of TBP from DNA, freeing the TBP to associate with other TATA boxes or TATA-less promoters. [provided by RefSeq, Sep 2011]
PHENOTYPE: Embryos homozygous for a gene-trapped allele display growth retardation. Embryos homozygous for an ENU-induced allele show growth retardation, edema, abnormal blood circulation, myocardial trabeculae hypoplasia, and delayed head and brain development. [provided by MGI curators]
Allele List at MGI

All alleles(40) : Gene trapped(40)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,636,639 probably null Het
Agxt2 A G 15: 10,399,159 D444G probably damaging Het
Aldh1b1 G T 4: 45,802,750 R96L probably damaging Het
Ank2 T C 3: 126,946,305 probably benign Het
Apob A G 12: 8,010,788 Y3090C probably damaging Het
Bbx A G 16: 50,223,356 S647P probably damaging Het
Brinp2 T C 1: 158,249,409 Y372C probably damaging Het
Cdk5rap1 T A 2: 154,345,974 E477D probably benign Het
Cfap65 G A 1: 74,907,518 probably benign Het
Chdh A G 14: 30,036,859 Y587C probably damaging Het
Chek2 T C 5: 110,868,035 V472A probably damaging Het
Clasrp A C 7: 19,586,856 I326S probably damaging Het
Clic6 A T 16: 92,499,454 Q334L possibly damaging Het
Cyp2d11 A T 15: 82,392,118 probably null Het
Entpd7 T C 19: 43,704,994 I171T probably damaging Het
Fosl1 T C 19: 5,455,267 probably benign Het
Gm10130 T C 2: 150,363,052 probably benign Het
Gm6124 A G 7: 39,220,198 noncoding transcript Het
H3f3a A T 1: 180,810,085 probably benign Het
Hs1bp3 AGAGGAGGAGGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGGAGGAGGAGG 12: 8,324,048 probably benign Het
Idh2 CCAGGGC CC 7: 80,098,339 probably null Het
Igkv3-7 A G 6: 70,608,006 Y110C probably damaging Het
Ints9 C T 14: 65,028,896 T399M possibly damaging Het
Kctd19 G A 8: 105,408,443 T62M probably damaging Het
Lsmem1 A G 12: 40,180,644 probably null Het
Obscn T C 11: 59,099,976 probably null Het
Olfr340 T C 2: 36,453,221 I212T probably benign Het
Olfr748 T C 14: 50,710,968 Y213H probably damaging Het
Otop3 T A 11: 115,339,339 M14K unknown Het
Pibf1 C T 14: 99,137,130 A335V possibly damaging Het
Pkd1l2 A T 8: 117,040,783 L1256* probably null Het
Plbd2 T C 5: 120,493,106 E202G probably benign Het
Ppp1r37 A G 7: 19,532,294 S516P probably damaging Het
Ppt2 G A 17: 34,617,399 T229M probably damaging Het
Prr14 A T 7: 127,476,397 I526F probably damaging Het
Scel T C 14: 103,583,139 probably benign Het
Scn9a A T 2: 66,565,029 probably benign Het
Senp6 T A 9: 80,089,876 D57E possibly damaging Het
Setd5 T C 6: 113,114,925 Y217H probably damaging Het
Sgcg T C 14: 61,225,305 T198A probably damaging Het
Sipa1 C T 19: 5,654,701 G622D probably benign Het
Slc27a2 C T 2: 126,564,690 A98V probably damaging Het
Slitrk3 G T 3: 73,050,404 P345Q probably benign Het
Slx4 T C 16: 3,985,788 D1054G possibly damaging Het
Sned1 A T 1: 93,282,361 T898S probably damaging Het
Tg C T 15: 66,693,435 P1209S probably damaging Het
Tmem63b C A 17: 45,667,763 V294L probably benign Het
Tnks G A 8: 34,940,861 R238C probably benign Het
Tsn G A 1: 118,305,214 T120I probably damaging Het
Txnrd1 T A 10: 82,895,980 F479I possibly damaging Het
Ubr1 T C 2: 120,915,407 M849V probably benign Het
Usp13 T C 3: 32,911,589 S574P probably damaging Het
Vmn1r69 A G 7: 10,580,508 Y20H probably damaging Het
Zfp780b T A 7: 27,964,827 N101I probably damaging Het
Other mutations in Btaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Btaf1 APN 19 37009702 missense probably damaging 1.00
IGL00535:Btaf1 APN 19 36997535 missense probably damaging 1.00
IGL00574:Btaf1 APN 19 36969930 missense probably benign 0.00
IGL00969:Btaf1 APN 19 37011252 splice site probably benign
IGL01325:Btaf1 APN 19 37004649 splice site probably benign
IGL01399:Btaf1 APN 19 37000170 nonsense probably null
IGL02024:Btaf1 APN 19 36992426 splice site probably benign
IGL02471:Btaf1 APN 19 37000192 missense probably damaging 0.96
IGL02664:Btaf1 APN 19 36978428 splice site probably benign
IGL02898:Btaf1 APN 19 36969068 missense probably benign
IGL02995:Btaf1 APN 19 36981135 splice site probably benign
IGL03023:Btaf1 APN 19 37010015 missense possibly damaging 0.85
IGL03188:Btaf1 APN 19 36949108 missense possibly damaging 0.91
IGL03353:Btaf1 APN 19 36992500 missense probably damaging 1.00
freudenberg UTSW 19 36988173 critical splice donor site probably null
Galanos UTSW 19 36949102 missense probably damaging 1.00
3-1:Btaf1 UTSW 19 37010078 missense probably damaging 1.00
R0013:Btaf1 UTSW 19 36958373 missense probably benign
R0048:Btaf1 UTSW 19 37003524 missense probably benign 0.01
R0117:Btaf1 UTSW 19 36969968 missense probably benign 0.06
R0207:Btaf1 UTSW 19 37009648 nonsense probably null
R0310:Btaf1 UTSW 19 37004534 missense probably damaging 0.96
R0377:Btaf1 UTSW 19 36989002 missense probably benign
R0419:Btaf1 UTSW 19 36945229 missense probably damaging 0.99
R0440:Btaf1 UTSW 19 36986653 missense probably damaging 0.99
R0532:Btaf1 UTSW 19 36951186 splice site probably benign
R0612:Btaf1 UTSW 19 36969137 missense probably damaging 0.99
R0731:Btaf1 UTSW 19 36997495 splice site probably null
R0780:Btaf1 UTSW 19 36988922 missense probably damaging 0.99
R0919:Btaf1 UTSW 19 36990743 missense probably benign 0.03
R1104:Btaf1 UTSW 19 37004602 missense probably damaging 1.00
R1263:Btaf1 UTSW 19 36956524 missense probably benign 0.10
R1325:Btaf1 UTSW 19 36969162 missense possibly damaging 0.68
R1447:Btaf1 UTSW 19 36992454 missense probably benign 0.00
R1554:Btaf1 UTSW 19 36996598 missense probably benign 0.02
R1649:Btaf1 UTSW 19 36981722 missense probably benign
R1715:Btaf1 UTSW 19 36969121 missense probably damaging 0.99
R1733:Btaf1 UTSW 19 36994962 missense probably benign
R1764:Btaf1 UTSW 19 36951118 missense probably benign 0.12
R1874:Btaf1 UTSW 19 36980583 missense probably benign
R1911:Btaf1 UTSW 19 36986630 missense probably benign
R1933:Btaf1 UTSW 19 36972957 missense probably damaging 1.00
R2080:Btaf1 UTSW 19 36951148 missense probably benign 0.09
R2483:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R2510:Btaf1 UTSW 19 37002445 missense probably benign 0.08
R3623:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R3624:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R3801:Btaf1 UTSW 19 36986548 missense probably benign
R3801:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R3802:Btaf1 UTSW 19 36986548 missense probably benign
R3802:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R3803:Btaf1 UTSW 19 36986548 missense probably benign
R3803:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R4077:Btaf1 UTSW 19 36986479 missense probably benign 0.00
R4079:Btaf1 UTSW 19 36986479 missense probably benign 0.00
R4133:Btaf1 UTSW 19 36961738 missense probably benign 0.00
R4673:Btaf1 UTSW 19 36978372 missense probably benign 0.00
R4731:Btaf1 UTSW 19 36981078 missense probably benign 0.03
R4796:Btaf1 UTSW 19 36956428 missense possibly damaging 0.95
R4824:Btaf1 UTSW 19 36981048 missense possibly damaging 0.84
R4835:Btaf1 UTSW 19 37002458 missense probably benign 0.00
R4837:Btaf1 UTSW 19 36966785 missense probably benign
R4925:Btaf1 UTSW 19 37011333 missense probably benign
R4968:Btaf1 UTSW 19 36969951 missense probably null 0.71
R4976:Btaf1 UTSW 19 36986579 missense probably benign
R5001:Btaf1 UTSW 19 36986652 missense possibly damaging 0.90
R5037:Btaf1 UTSW 19 37003531 missense probably damaging 1.00
R5039:Btaf1 UTSW 19 36990762 missense probably benign
R5211:Btaf1 UTSW 19 36996562 missense probably benign 0.32
R5422:Btaf1 UTSW 19 36951107 missense probably benign 0.09
R5429:Btaf1 UTSW 19 36994857 missense possibly damaging 0.58
R5530:Btaf1 UTSW 19 36990775 missense possibly damaging 0.85
R5654:Btaf1 UTSW 19 36983615 missense probably benign 0.35
R5744:Btaf1 UTSW 19 37004490 missense probably benign 0.02
R6082:Btaf1 UTSW 19 36983542 missense probably damaging 1.00
R6243:Btaf1 UTSW 19 36981120 missense probably benign 0.02
R6291:Btaf1 UTSW 19 36973008 missense probably benign 0.00
R6502:Btaf1 UTSW 19 36983617 missense probably benign
R7034:Btaf1 UTSW 19 37004469 missense probably benign
R7036:Btaf1 UTSW 19 37004469 missense probably benign
R7085:Btaf1 UTSW 19 36972918 missense probably benign
R7097:Btaf1 UTSW 19 36949102 missense probably damaging 1.00
R7248:Btaf1 UTSW 19 36945314 missense possibly damaging 0.54
R7386:Btaf1 UTSW 19 36958382 missense probably benign 0.02
R7402:Btaf1 UTSW 19 37003515 missense probably damaging 1.00
R7452:Btaf1 UTSW 19 36969127 missense probably damaging 1.00
R7493:Btaf1 UTSW 19 37009605 missense probably damaging 1.00
R7513:Btaf1 UTSW 19 36978403 missense probably benign 0.30
R7888:Btaf1 UTSW 19 36965636 missense probably benign 0.10
R7944:Btaf1 UTSW 19 36949165 missense probably benign
R8062:Btaf1 UTSW 19 36992465 missense probably benign 0.00
R8559:Btaf1 UTSW 19 36986873 missense probably benign 0.00
R8793:Btaf1 UTSW 19 36981029 missense probably benign 0.21
R8855:Btaf1 UTSW 19 36958501 missense probably benign
R8866:Btaf1 UTSW 19 36958501 missense probably benign
W0251:Btaf1 UTSW 19 37003504 missense probably damaging 1.00
X0027:Btaf1 UTSW 19 36949096 nonsense probably null
Z1088:Btaf1 UTSW 19 36986618 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAATGCACCATACTGTCACC -3'
(R):5'- CTATGTCTTAGGGCAGAGGCAAAG -3'

Sequencing Primer
(F):5'- TACTGTCACCAAGCACAGGGG -3'
(R):5'- TGCATCCCTGTCCTGAAATAC -3'
Posted On2016-10-26