Mutagenetix > Incidental Mutation

Incidental Mutation 'R5582:Entpd7'

438538

Institutional Source

Beutler Lab

Gene Symbol

Entpd7

Ensembl Gene

ENSMUSG00000025192

Gene Name

ectonucleoside triphosphate diphosphohydrolase 7

Synonyms

1810020C02Rik, 2810003F23Rik, 1810012B13Rik, LALP1, Lysal2

MMRRC Submission

043136-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.107) question?

Stock #

R5582 (G1)

Quality Score

223

Status

Validated

Chromosome

Chromosomal Location

43689672-43733697 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 43704994 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 171 (I171T)

Ref Sequence

ENSEMBL: ENSMUSP00000079864 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081079]

AlphaFold

Q3TCT4

Predicted Effect

probably damaging
Transcript: ENSMUST00000081079
AA Change: I171T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000079864
Gene: ENSMUSG00000025192
AA Change: I171T

Domain	Start	End	E-Value	Type
transmembrane domain	30	52	N/A	INTRINSIC
Pfam:GDA1_CD39	75	534	3.6e-106	PFAM
transmembrane domain	550	572	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144314

Meta Mutation Damage Score

0.6536

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.6%

Validation Efficiency

98% (61/62)

MGI Phenotype

PHENOTYPE: Mice homozygous for deletions in this gene have increased Th17 T cell levels in the lamina propria of the small intestine. They show increased resistance to Citrobacter rodentium infection and increased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	C	11: 9,636,639		probably null	Het
Agxt2	A	G	15: 10,399,159	D444G	probably damaging	Het
Aldh1b1	G	T	4: 45,802,750	R96L	probably damaging	Het
Ank2	T	C	3: 126,946,305		probably benign	Het
Apob	A	G	12: 8,010,788	Y3090C	probably damaging	Het
Bbx	A	G	16: 50,223,356	S647P	probably damaging	Het
Brinp2	T	C	1: 158,249,409	Y372C	probably damaging	Het
Btaf1	T	C	19: 36,988,173		probably null	Het
Cdk5rap1	T	A	2: 154,345,974	E477D	probably benign	Het
Cfap65	G	A	1: 74,907,518		probably benign	Het
Chdh	A	G	14: 30,036,859	Y587C	probably damaging	Het
Chek2	T	C	5: 110,868,035	V472A	probably damaging	Het
Clasrp	A	C	7: 19,586,856	I326S	probably damaging	Het
Clic6	A	T	16: 92,499,454	Q334L	possibly damaging	Het
Cyp2d11	A	T	15: 82,392,118		probably null	Het
Fosl1	T	C	19: 5,455,267		probably benign	Het
Gm10130	T	C	2: 150,363,052		probably benign	Het
Gm6124	A	G	7: 39,220,198		noncoding transcript	Het
H3f3a	A	T	1: 180,810,085		probably benign	Het
Hs1bp3	AGAGGAGGAGGAGGAGGAGGAGGAGGAGG	AGAGGAGGAGGAGGAGGAGGAGGAGG	12: 8,324,048		probably benign	Het
Idh2	CCAGGGC	CC	7: 80,098,339		probably null	Het
Igkv3-7	A	G	6: 70,608,006	Y110C	probably damaging	Het
Ints9	C	T	14: 65,028,896	T399M	possibly damaging	Het
Kctd19	G	A	8: 105,408,443	T62M	probably damaging	Het
Lsmem1	A	G	12: 40,180,644		probably null	Het
Obscn	T	C	11: 59,099,976		probably null	Het
Olfr340	T	C	2: 36,453,221	I212T	probably benign	Het
Olfr748	T	C	14: 50,710,968	Y213H	probably damaging	Het
Otop3	T	A	11: 115,339,339	M14K	unknown	Het
Pibf1	C	T	14: 99,137,130	A335V	possibly damaging	Het
Pkd1l2	A	T	8: 117,040,783	L1256*	probably null	Het
Plbd2	T	C	5: 120,493,106	E202G	probably benign	Het
Ppp1r37	A	G	7: 19,532,294	S516P	probably damaging	Het
Ppt2	G	A	17: 34,617,399	T229M	probably damaging	Het
Prr14	A	T	7: 127,476,397	I526F	probably damaging	Het
Scel	T	C	14: 103,583,139		probably benign	Het
Scn9a	A	T	2: 66,565,029		probably benign	Het
Senp6	T	A	9: 80,089,876	D57E	possibly damaging	Het
Setd5	T	C	6: 113,114,925	Y217H	probably damaging	Het
Sgcg	T	C	14: 61,225,305	T198A	probably damaging	Het
Sipa1	C	T	19: 5,654,701	G622D	probably benign	Het
Slc27a2	C	T	2: 126,564,690	A98V	probably damaging	Het
Slitrk3	G	T	3: 73,050,404	P345Q	probably benign	Het
Slx4	T	C	16: 3,985,788	D1054G	possibly damaging	Het
Sned1	A	T	1: 93,282,361	T898S	probably damaging	Het
Tg	C	T	15: 66,693,435	P1209S	probably damaging	Het
Tmem63b	C	A	17: 45,667,763	V294L	probably benign	Het
Tnks	G	A	8: 34,940,861	R238C	probably benign	Het
Tsn	G	A	1: 118,305,214	T120I	probably damaging	Het
Txnrd1	T	A	10: 82,895,980	F479I	possibly damaging	Het
Ubr1	T	C	2: 120,915,407	M849V	probably benign	Het
Usp13	T	C	3: 32,911,589	S574P	probably damaging	Het
Vmn1r69	A	G	7: 10,580,508	Y20H	probably damaging	Het
Zfp780b	T	A	7: 27,964,827	N101I	probably damaging	Het

Other mutations in Entpd7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01431:Entpd7	APN	19	43729839	missense	probably benign	0.00
R0056:Entpd7	UTSW	19	43725294	missense	probably benign	0.09
R0118:Entpd7	UTSW	19	43704312	nonsense	probably null
R0639:Entpd7	UTSW	19	43691094	missense	probably benign	0.42
R1479:Entpd7	UTSW	19	43721840	missense	probably damaging	1.00
R1532:Entpd7	UTSW	19	43691077	missense	possibly damaging	0.76
R1647:Entpd7	UTSW	19	43721745	splice site	probably benign
R1689:Entpd7	UTSW	19	43725476	missense	probably damaging	0.96
R2230:Entpd7	UTSW	19	43721816	missense	probably benign	0.07
R2231:Entpd7	UTSW	19	43721816	missense	probably benign	0.07
R2422:Entpd7	UTSW	19	43728088	missense	possibly damaging	0.66
R3807:Entpd7	UTSW	19	43725540	critical splice donor site	probably null
R3914:Entpd7	UTSW	19	43691158	missense	probably benign	0.00
R3949:Entpd7	UTSW	19	43691158	missense	probably benign	0.00
R4021:Entpd7	UTSW	19	43691158	missense	probably benign	0.00
R4022:Entpd7	UTSW	19	43691158	missense	probably benign	0.00
R4095:Entpd7	UTSW	19	43704201	missense	probably damaging	1.00
R4737:Entpd7	UTSW	19	43691195	nonsense	probably null
R5653:Entpd7	UTSW	19	43691157	nonsense	probably null
R5763:Entpd7	UTSW	19	43704266	missense	probably damaging	1.00
R6508:Entpd7	UTSW	19	43691086	missense	probably damaging	1.00
R7657:Entpd7	UTSW	19	43725467	missense	possibly damaging	0.67
R8013:Entpd7	UTSW	19	43728055	missense	probably benign	0.00
R8235:Entpd7	UTSW	19	43717545	missense	probably damaging	1.00
R8880:Entpd7	UTSW	19	43704407	splice site	probably benign
R9318:Entpd7	UTSW	19	43704270	missense	possibly damaging	0.88
R9564:Entpd7	UTSW	19	43717450	missense	probably benign	0.01
Z1176:Entpd7	UTSW	19	43725358	missense	probably benign	0.43
Z1177:Entpd7	UTSW	19	43725497	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAATGTAGGTCCTTCCACAGG -3'
(R):5'- GATGTGACTGTCTGACCGTG -3'

Sequencing Primer
(F):5'- GCTGGGATTAAAGGATTACACCCC -3'
(R):5'- TGTCTGACCGTGCGTCACTG -3'

Posted On

2016-10-26