Incidental Mutation 'R5583:Gon4l'
ID438551
Institutional Source Beutler Lab
Gene Symbol Gon4l
Ensembl Gene ENSMUSG00000054199
Gene Namegon-4-like (C.elegans)
Synonyms2610100B20Rik, 1500041I23Rik
MMRRC Submission 043137-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.770) question?
Stock #R5583 (G1)
Quality Score181
Status Not validated
Chromosome3
Chromosomal Location88835231-88910103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88899971 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1658 (D1658E)
Ref Sequence ENSEMBL: ENSMUSP00000088461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081695] [ENSMUST00000090942] [ENSMUST00000107498]
Predicted Effect probably damaging
Transcript: ENSMUST00000081695
AA Change: D1657E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080397
Gene: ENSMUSG00000054199
AA Change: D1657E

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090942
AA Change: D1658E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088461
Gene: ENSMUSG00000054199
AA Change: D1658E

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 241 257 N/A INTRINSIC
low complexity region 349 378 N/A INTRINSIC
low complexity region 433 440 N/A INTRINSIC
low complexity region 528 543 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
Blast:SANT 814 866 2e-23 BLAST
low complexity region 962 976 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1419 1435 N/A INTRINSIC
low complexity region 1453 1498 N/A INTRINSIC
low complexity region 1508 1542 N/A INTRINSIC
Pfam:PAH 1654 1700 2.1e-8 PFAM
low complexity region 1801 1812 N/A INTRINSIC
coiled coil region 1920 1944 N/A INTRINSIC
low complexity region 2086 2095 N/A INTRINSIC
SANT 2154 2205 2.2e-1 SMART
low complexity region 2208 2223 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107498
AA Change: D1657E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103122
Gene: ENSMUSG00000054199
AA Change: D1657E

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198251
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 97% (60/62)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit arrested B cell development at the early pro-B cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik G A 7: 140,296,826 C710Y probably damaging Het
A1bg A T 15: 60,921,234 L8Q probably damaging Het
Abca4 T C 3: 122,148,901 V1681A probably damaging Het
Abce1 G T 8: 79,690,293 A363E probably benign Het
Adgrl2 T C 3: 148,859,164 Y256C probably damaging Het
Afm T C 5: 90,547,881 C416R probably damaging Het
Ahnak T A 19: 9,006,917 V1855D probably damaging Het
Alb A T 5: 90,468,593 H319L probably benign Het
Ankrd35 G T 3: 96,684,903 R835L probably damaging Het
Atg2b T C 12: 105,649,155 D1014G possibly damaging Het
Cdk6 T A 5: 3,344,436 Y24N probably damaging Het
Chd7 T A 4: 8,752,473 N323K probably damaging Het
Cops9 A T 1: 92,639,767 probably benign Het
Crybg1 T C 10: 44,003,510 T561A probably benign Het
Dcdc5 T C 2: 106,365,433 noncoding transcript Het
Dnah7b G T 1: 46,242,199 A2807S probably benign Het
Fam149b A G 14: 20,363,300 T196A possibly damaging Het
Fam217a C A 13: 34,910,297 C402F probably damaging Het
Fat2 A T 11: 55,253,889 V4053E probably benign Het
Fcgbp T C 7: 28,091,579 V755A probably damaging Het
Fxr1 C A 3: 34,068,976 S641R probably benign Het
Gata5 A T 2: 180,334,254 M39K probably benign Het
Gpr180 C T 14: 118,162,698 T426M probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Helq T C 5: 100,762,593 E1039G probably damaging Het
Hibch T A 1: 52,901,247 Y192N probably damaging Het
Hp1bp3 A G 4: 138,222,115 I41M probably damaging Het
Itpripl2 G T 7: 118,489,878 P486Q probably benign Het
Kcnj6 T C 16: 94,833,201 D17G probably benign Het
Kprp T A 3: 92,824,336 Y469F unknown Het
Kremen2 T C 17: 23,742,255 T373A probably benign Het
Lgi4 A G 7: 31,061,137 Y39C possibly damaging Het
Lgr5 T C 10: 115,478,504 D176G probably benign Het
Lrp1 T C 10: 127,588,463 S785G probably benign Het
Ltbp1 A T 17: 75,291,330 Q920L probably benign Het
Map2 A G 1: 66,416,037 E1362G probably damaging Het
Nkx2-6 T C 14: 69,171,823 S8P probably damaging Het
Olfr93 T C 17: 37,151,594 Q126R probably benign Het
Pde4dip C T 3: 97,747,576 R888Q possibly damaging Het
Per1 A G 11: 69,103,445 H494R probably damaging Het
Pira2 A G 7: 3,842,546 F280L probably benign Het
Plekhm3 C T 1: 64,937,986 W108* probably null Het
Ptcd3 A G 6: 71,902,936 S113P probably damaging Het
Scarf1 T C 11: 75,514,016 L42P possibly damaging Het
Skint1 A C 4: 112,019,056 Q58P probably damaging Het
Spata7 A T 12: 98,669,331 N438I probably damaging Het
Spdya C A 17: 71,569,131 D164E probably damaging Het
Speer3 G A 5: 13,794,768 probably null Het
Ssc4d A T 5: 135,970,196 L51H probably damaging Het
Steap1 A G 5: 5,740,579 I123T possibly damaging Het
Styx T A 14: 45,371,026 F147I possibly damaging Het
Suv39h2 T A 2: 3,474,853 probably benign Het
Tfb2m A G 1: 179,545,881 V84A probably benign Het
Tlcd1 T G 11: 78,178,936 V25G probably benign Het
Tmem79 T C 3: 88,332,563 Y280C probably damaging Het
Trim5 T A 7: 104,276,835 N173I probably damaging Het
Ttc17 A T 2: 94,377,682 D194E probably damaging Het
Zfp2 T C 11: 50,900,157 E353G possibly damaging Het
Other mutations in Gon4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Gon4l APN 3 88857185 missense probably damaging 1.00
IGL02002:Gon4l APN 3 88895336 missense possibly damaging 0.46
IGL02065:Gon4l APN 3 88857210 missense probably null 1.00
IGL02283:Gon4l APN 3 88895364 missense probably damaging 0.99
IGL02669:Gon4l APN 3 88895499 missense probably damaging 1.00
IGL03222:Gon4l APN 3 88895643 missense possibly damaging 0.56
IGL03385:Gon4l APN 3 88907543 missense probably benign 0.10
PIT4581001:Gon4l UTSW 3 88895514 missense probably damaging 1.00
R0020:Gon4l UTSW 3 88858937 missense probably damaging 1.00
R0115:Gon4l UTSW 3 88895682 missense probably damaging 1.00
R0173:Gon4l UTSW 3 88858403 missense probably damaging 1.00
R0270:Gon4l UTSW 3 88858400 missense probably damaging 1.00
R0961:Gon4l UTSW 3 88898096 splice site probably benign
R1017:Gon4l UTSW 3 88858496 missense probably benign 0.15
R1163:Gon4l UTSW 3 88892535 missense probably damaging 1.00
R1729:Gon4l UTSW 3 88903098 missense probably damaging 1.00
R1764:Gon4l UTSW 3 88892599 missense probably damaging 1.00
R1861:Gon4l UTSW 3 88895487 missense probably damaging 1.00
R2141:Gon4l UTSW 3 88887595 missense possibly damaging 0.66
R2347:Gon4l UTSW 3 88863517 missense probably damaging 1.00
R2402:Gon4l UTSW 3 88859043 missense probably damaging 1.00
R2842:Gon4l UTSW 3 88895487 missense probably damaging 1.00
R4375:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4376:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4377:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4569:Gon4l UTSW 3 88910090 intron probably benign
R4650:Gon4l UTSW 3 88863552 missense possibly damaging 0.94
R4859:Gon4l UTSW 3 88895348 missense probably benign 0.00
R4901:Gon4l UTSW 3 88908151 missense possibly damaging 0.50
R4998:Gon4l UTSW 3 88899998 missense probably damaging 1.00
R5059:Gon4l UTSW 3 88900012 missense probably benign 0.00
R5217:Gon4l UTSW 3 88887575 missense probably damaging 1.00
R5269:Gon4l UTSW 3 88895528 missense probably benign
R5279:Gon4l UTSW 3 88887637 missense probably benign
R5283:Gon4l UTSW 3 88887590 missense probably damaging 1.00
R5386:Gon4l UTSW 3 88858496 missense probably benign 0.15
R5433:Gon4l UTSW 3 88896225 missense possibly damaging 0.93
R5695:Gon4l UTSW 3 88896216 frame shift probably null
R5921:Gon4l UTSW 3 88909947 intron probably benign
R6003:Gon4l UTSW 3 88896093 missense probably damaging 0.99
R6063:Gon4l UTSW 3 88899999 missense probably damaging 1.00
R6217:Gon4l UTSW 3 88892661 missense possibly damaging 0.62
R6273:Gon4l UTSW 3 88855849 missense probably damaging 1.00
R6280:Gon4l UTSW 3 88890888 missense probably damaging 1.00
R6790:Gon4l UTSW 3 88858998 missense probably damaging 1.00
R6829:Gon4l UTSW 3 88880106 missense possibly damaging 0.96
R6891:Gon4l UTSW 3 88858866 splice site probably null
R7128:Gon4l UTSW 3 88895692 missense possibly damaging 0.94
R7315:Gon4l UTSW 3 88895179 missense probably benign 0.00
R7355:Gon4l UTSW 3 88863520 missense probably damaging 1.00
R7426:Gon4l UTSW 3 88907522 missense probably benign
R7635:Gon4l UTSW 3 88895106 missense probably benign 0.03
R7643:Gon4l UTSW 3 88902807 missense probably damaging 1.00
R7715:Gon4l UTSW 3 88908006 missense probably benign
R7773:Gon4l UTSW 3 88895795 missense probably benign 0.00
R8090:Gon4l UTSW 3 88892624 missense probably damaging 1.00
R8224:Gon4l UTSW 3 88895142 missense probably damaging 1.00
R8260:Gon4l UTSW 3 88892630 missense probably damaging 0.98
R8434:Gon4l UTSW 3 88854779 missense probably damaging 1.00
Z1177:Gon4l UTSW 3 88859036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGAGTTGTGCCTTGCTG -3'
(R):5'- GCTGTAAAGTCTTTGCCCGTC -3'

Sequencing Primer
(F):5'- GTGTTGTTACTCCTTGGGTCAGAG -3'
(R):5'- TGCCCGTCAAAGTGGACTTAC -3'
Posted On2016-10-26