Incidental Mutation 'R5583:Fam217a'
ID438585
Institutional Source Beutler Lab
Gene Symbol Fam217a
Ensembl Gene ENSMUSG00000021414
Gene Namefamily with sequence similarity 217, member A
Synonyms
MMRRC Submission 043137-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R5583 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location34909960-34924310 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34910297 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 402 (C402F)
Ref Sequence ENSEMBL: ENSMUSP00000153128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021851] [ENSMUST00000077853] [ENSMUST00000223834] [ENSMUST00000225242]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021851
AA Change: C493F

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021851
Gene: ENSMUSG00000021414
AA Change: C493F

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:FAM217 206 411 2e-54 PFAM
low complexity region 425 436 N/A INTRINSIC
low complexity region 444 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077853
SMART Domains Protein: ENSMUSP00000077019
Gene: ENSMUSG00000021413

DomainStartEndE-ValueType
low complexity region 40 62 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
coiled coil region 102 123 N/A INTRINSIC
low complexity region 142 150 N/A INTRINSIC
low complexity region 156 170 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
low complexity region 210 233 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 284 294 N/A INTRINSIC
low complexity region 299 324 N/A INTRINSIC
low complexity region 340 360 N/A INTRINSIC
low complexity region 390 417 N/A INTRINSIC
low complexity region 435 497 N/A INTRINSIC
low complexity region 521 535 N/A INTRINSIC
low complexity region 562 581 N/A INTRINSIC
S_TKc 687 1003 4.99e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223228
Predicted Effect possibly damaging
Transcript: ENSMUST00000223834
AA Change: C645F

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224613
Predicted Effect probably damaging
Transcript: ENSMUST00000225242
AA Change: C402F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.2017 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 97% (60/62)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik G A 7: 140,296,826 C710Y probably damaging Het
A1bg A T 15: 60,921,234 L8Q probably damaging Het
Abca4 T C 3: 122,148,901 V1681A probably damaging Het
Abce1 G T 8: 79,690,293 A363E probably benign Het
Adgrl2 T C 3: 148,859,164 Y256C probably damaging Het
Afm T C 5: 90,547,881 C416R probably damaging Het
Ahnak T A 19: 9,006,917 V1855D probably damaging Het
Alb A T 5: 90,468,593 H319L probably benign Het
Ankrd35 G T 3: 96,684,903 R835L probably damaging Het
Atg2b T C 12: 105,649,155 D1014G possibly damaging Het
Cdk6 T A 5: 3,344,436 Y24N probably damaging Het
Chd7 T A 4: 8,752,473 N323K probably damaging Het
Cops9 A T 1: 92,639,767 probably benign Het
Crybg1 T C 10: 44,003,510 T561A probably benign Het
Dcdc5 T C 2: 106,365,433 noncoding transcript Het
Dnah7b G T 1: 46,242,199 A2807S probably benign Het
Fam149b A G 14: 20,363,300 T196A possibly damaging Het
Fat2 A T 11: 55,253,889 V4053E probably benign Het
Fcgbp T C 7: 28,091,579 V755A probably damaging Het
Fxr1 C A 3: 34,068,976 S641R probably benign Het
Gata5 A T 2: 180,334,254 M39K probably benign Het
Gon4l T A 3: 88,899,971 D1658E probably damaging Het
Gpr180 C T 14: 118,162,698 T426M probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Helq T C 5: 100,762,593 E1039G probably damaging Het
Hibch T A 1: 52,901,247 Y192N probably damaging Het
Hp1bp3 A G 4: 138,222,115 I41M probably damaging Het
Itpripl2 G T 7: 118,489,878 P486Q probably benign Het
Kcnj6 T C 16: 94,833,201 D17G probably benign Het
Kprp T A 3: 92,824,336 Y469F unknown Het
Kremen2 T C 17: 23,742,255 T373A probably benign Het
Lgi4 A G 7: 31,061,137 Y39C possibly damaging Het
Lgr5 T C 10: 115,478,504 D176G probably benign Het
Lrp1 T C 10: 127,588,463 S785G probably benign Het
Ltbp1 A T 17: 75,291,330 Q920L probably benign Het
Map2 A G 1: 66,416,037 E1362G probably damaging Het
Nkx2-6 T C 14: 69,171,823 S8P probably damaging Het
Olfr93 T C 17: 37,151,594 Q126R probably benign Het
Pde4dip C T 3: 97,747,576 R888Q possibly damaging Het
Per1 A G 11: 69,103,445 H494R probably damaging Het
Pira2 A G 7: 3,842,546 F280L probably benign Het
Plekhm3 C T 1: 64,937,986 W108* probably null Het
Ptcd3 A G 6: 71,902,936 S113P probably damaging Het
Scarf1 T C 11: 75,514,016 L42P possibly damaging Het
Skint1 A C 4: 112,019,056 Q58P probably damaging Het
Spata7 A T 12: 98,669,331 N438I probably damaging Het
Spdya C A 17: 71,569,131 D164E probably damaging Het
Speer3 G A 5: 13,794,768 probably null Het
Ssc4d A T 5: 135,970,196 L51H probably damaging Het
Steap1 A G 5: 5,740,579 I123T possibly damaging Het
Styx T A 14: 45,371,026 F147I possibly damaging Het
Suv39h2 T A 2: 3,474,853 probably benign Het
Tfb2m A G 1: 179,545,881 V84A probably benign Het
Tlcd1 T G 11: 78,178,936 V25G probably benign Het
Tmem79 T C 3: 88,332,563 Y280C probably damaging Het
Trim5 T A 7: 104,276,835 N173I probably damaging Het
Ttc17 A T 2: 94,377,682 D194E probably damaging Het
Zfp2 T C 11: 50,900,157 E353G possibly damaging Het
Other mutations in Fam217a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Fam217a APN 13 34915649 splice site probably benign
IGL02222:Fam217a APN 13 34911119 missense probably damaging 1.00
IGL02302:Fam217a APN 13 34911161 missense probably damaging 1.00
IGL02371:Fam217a APN 13 34911401 missense possibly damaging 0.53
IGL02538:Fam217a APN 13 34911113 missense probably damaging 0.98
R0324:Fam217a UTSW 13 34910961 missense possibly damaging 0.71
R0616:Fam217a UTSW 13 34913683 missense probably benign 0.03
R1497:Fam217a UTSW 13 34911212 missense probably damaging 0.97
R1934:Fam217a UTSW 13 34910881 missense probably damaging 1.00
R1981:Fam217a UTSW 13 34916754 missense probably benign 0.07
R2133:Fam217a UTSW 13 34913680 missense probably damaging 1.00
R2344:Fam217a UTSW 13 34910335 missense probably damaging 1.00
R4182:Fam217a UTSW 13 34910256 missense possibly damaging 0.75
R4601:Fam217a UTSW 13 34911302 missense probably damaging 1.00
R4909:Fam217a UTSW 13 34910406 missense probably damaging 1.00
R6027:Fam217a UTSW 13 34910994 missense possibly damaging 0.77
R6496:Fam217a UTSW 13 34910802 nonsense probably null
R7166:Fam217a UTSW 13 34910315 missense probably benign 0.07
R7394:Fam217a UTSW 13 34910279 missense possibly damaging 0.73
R7710:Fam217a UTSW 13 34911128 missense possibly damaging 0.92
R8409:Fam217a UTSW 13 34916898 missense probably benign
R8716:Fam217a UTSW 13 34924265 start gained probably benign
R8782:Fam217a UTSW 13 34911050 missense probably benign
R8936:Fam217a UTSW 13 34911164 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGACATTCATGAGTTCTACCC -3'
(R):5'- TTAAACCCTTGCCAGGAACC -3'

Sequencing Primer
(F):5'- GAGTTCTACCCATGTCTTATCAAGG -3'
(R):5'- TCAACCAATGGCTAGAGTGGTCTC -3'
Posted On2016-10-26