Incidental Mutation 'R5583:Kcnj6'
ID438592
Institutional Source Beutler Lab
Gene Symbol Kcnj6
Ensembl Gene ENSMUSG00000043301
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 6
SynonymsKCNJ7, GIRK2, Kir3.2
MMRRC Submission 043137-MU
Accession Numbers

Genbank: NM_001025584.2, NM_001025585.2, NM_001025590.1, NM_010606.2  

Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5583 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location94748636-94997701 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94833201 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 17 (D17G)
Ref Sequence ENSEMBL: ENSMUSP00000093558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095873] [ENSMUST00000099508] [ENSMUST00000165538] [ENSMUST00000232562]
PDB Structure
Crystal Structure of the Cytoplasmic Domain of G-Protein-Gated Inward Rectifier Potassium Channel Kir3.2 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000095873
AA Change: D17G

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000093558
Gene: ENSMUSG00000043301
AA Change: D17G

DomainStartEndE-ValueType
Pfam:IRK 59 397 9.3e-166 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099508
AA Change: D17G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000097108
Gene: ENSMUSG00000043301
AA Change: D17G

DomainStartEndE-ValueType
Pfam:IRK 59 382 8.5e-146 PFAM
low complexity region 396 411 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165538
SMART Domains Protein: ENSMUSP00000130321
Gene: ENSMUSG00000043301

DomainStartEndE-ValueType
Pfam:IRK 41 302 5.3e-122 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232403
Predicted Effect probably benign
Transcript: ENSMUST00000232562
Meta Mutation Damage Score 0.0618 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled inwardly-rectifying potassium channel family of inward rectifier potassium channels. This type of potassium channel allows a greater flow of potassium into the cell than out of it. These proteins modulate many physiological processes, including heart rate in cardiac cells and circuit activity in neuronal cells, through G-protein coupled receptor stimulation. Mutations in this gene are associated with Keppen-Lubinsky Syndrome, a rare condition characterized by severe developmental delay, facial dysmorphism, and intellectual disability. [provided by RefSeq, Apr 2015]
PHENOTYPE: A spontaneous mutation exhibits small size, ataxia, hypotonia, high periweaning mortality, Purkinje cell defects, and male sterility. Homozygotes for a targeted null mutation exhibit increased susceptibility to spontaneous and drug-induced seizures. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Gene trapped(1) Spontaneous(1)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik G A 7: 140,296,826 C710Y probably damaging Het
A1bg A T 15: 60,921,234 L8Q probably damaging Het
Abca4 T C 3: 122,148,901 V1681A probably damaging Het
Abce1 G T 8: 79,690,293 A363E probably benign Het
Adgrl2 T C 3: 148,859,164 Y256C probably damaging Het
Afm T C 5: 90,547,881 C416R probably damaging Het
Ahnak T A 19: 9,006,917 V1855D probably damaging Het
Alb A T 5: 90,468,593 H319L probably benign Het
Ankrd35 G T 3: 96,684,903 R835L probably damaging Het
Atg2b T C 12: 105,649,155 D1014G possibly damaging Het
Cdk6 T A 5: 3,344,436 Y24N probably damaging Het
Chd7 T A 4: 8,752,473 N323K probably damaging Het
Cops9 A T 1: 92,639,767 probably benign Het
Crybg1 T C 10: 44,003,510 T561A probably benign Het
Dcdc5 T C 2: 106,365,433 noncoding transcript Het
Dnah7b G T 1: 46,242,199 A2807S probably benign Het
Fam149b A G 14: 20,363,300 T196A possibly damaging Het
Fam217a C A 13: 34,910,297 C402F probably damaging Het
Fat2 A T 11: 55,253,889 V4053E probably benign Het
Fcgbp T C 7: 28,091,579 V755A probably damaging Het
Fxr1 C A 3: 34,068,976 S641R probably benign Het
Gata5 A T 2: 180,334,254 M39K probably benign Het
Gon4l T A 3: 88,899,971 D1658E probably damaging Het
Gpr180 C T 14: 118,162,698 T426M probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Helq T C 5: 100,762,593 E1039G probably damaging Het
Hibch T A 1: 52,901,247 Y192N probably damaging Het
Hp1bp3 A G 4: 138,222,115 I41M probably damaging Het
Itpripl2 G T 7: 118,489,878 P486Q probably benign Het
Kprp T A 3: 92,824,336 Y469F unknown Het
Kremen2 T C 17: 23,742,255 T373A probably benign Het
Lgi4 A G 7: 31,061,137 Y39C possibly damaging Het
Lgr5 T C 10: 115,478,504 D176G probably benign Het
Lrp1 T C 10: 127,588,463 S785G probably benign Het
Ltbp1 A T 17: 75,291,330 Q920L probably benign Het
Map2 A G 1: 66,416,037 E1362G probably damaging Het
Nkx2-6 T C 14: 69,171,823 S8P probably damaging Het
Olfr93 T C 17: 37,151,594 Q126R probably benign Het
Pde4dip C T 3: 97,747,576 R888Q possibly damaging Het
Per1 A G 11: 69,103,445 H494R probably damaging Het
Pira2 A G 7: 3,842,546 F280L probably benign Het
Plekhm3 C T 1: 64,937,986 W108* probably null Het
Ptcd3 A G 6: 71,902,936 S113P probably damaging Het
Scarf1 T C 11: 75,514,016 L42P possibly damaging Het
Skint1 A C 4: 112,019,056 Q58P probably damaging Het
Spata7 A T 12: 98,669,331 N438I probably damaging Het
Spdya C A 17: 71,569,131 D164E probably damaging Het
Speer3 G A 5: 13,794,768 probably null Het
Ssc4d A T 5: 135,970,196 L51H probably damaging Het
Steap1 A G 5: 5,740,579 I123T possibly damaging Het
Styx T A 14: 45,371,026 F147I possibly damaging Het
Suv39h2 T A 2: 3,474,853 probably benign Het
Tfb2m A G 1: 179,545,881 V84A probably benign Het
Tlcd1 T G 11: 78,178,936 V25G probably benign Het
Tmem79 T C 3: 88,332,563 Y280C probably damaging Het
Trim5 T A 7: 104,276,835 N173I probably damaging Het
Ttc17 A T 2: 94,377,682 D194E probably damaging Het
Zfp2 T C 11: 50,900,157 E353G possibly damaging Het
Other mutations in Kcnj6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Kcnj6 APN 16 94832455 missense probably damaging 0.99
IGL01433:Kcnj6 APN 16 94832955 missense probably benign 0.21
IGL01603:Kcnj6 APN 16 94833199 missense probably benign 0.00
IGL02212:Kcnj6 APN 16 94832487 missense probably damaging 1.00
IGL02982:Kcnj6 APN 16 94832517 missense possibly damaging 0.89
IGL03351:Kcnj6 APN 16 94832583 missense probably damaging 1.00
Seizure UTSW 16 94832659 missense probably damaging 1.00
H8477:Kcnj6 UTSW 16 94832937 missense probably damaging 1.00
IGL02796:Kcnj6 UTSW 16 94832919 missense probably benign 0.00
R0070:Kcnj6 UTSW 16 94941197 missense probably benign
R1558:Kcnj6 UTSW 16 94762499 missense possibly damaging 0.57
R1676:Kcnj6 UTSW 16 94832584 missense probably damaging 1.00
R2435:Kcnj6 UTSW 16 94762679 missense probably damaging 0.99
R3700:Kcnj6 UTSW 16 94833006 missense probably damaging 0.96
R3800:Kcnj6 UTSW 16 94833027 missense probably damaging 1.00
R4012:Kcnj6 UTSW 16 94825018 splice site probably null
R4899:Kcnj6 UTSW 16 94832613 missense probably damaging 1.00
R5124:Kcnj6 UTSW 16 94832659 missense probably damaging 1.00
R5359:Kcnj6 UTSW 16 94832453 nonsense probably null
R5560:Kcnj6 UTSW 16 94832965 missense probably benign 0.06
R6057:Kcnj6 UTSW 16 94832377 missense probably damaging 1.00
R6330:Kcnj6 UTSW 16 94762601 missense possibly damaging 0.93
R6582:Kcnj6 UTSW 16 94832826 missense possibly damaging 0.93
R6604:Kcnj6 UTSW 16 94762645 missense probably damaging 1.00
R6802:Kcnj6 UTSW 16 94762577 missense probably benign 0.06
R6866:Kcnj6 UTSW 16 94762677 missense probably damaging 1.00
R7304:Kcnj6 UTSW 16 94941183 missense probably benign
R7337:Kcnj6 UTSW 16 94833214 missense probably benign 0.10
R7396:Kcnj6 UTSW 16 94762447 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGAATCTCCACTTCAGGTCCAC -3'
(R):5'- AGATTGGCTCTGTTCACCTAG -3'

Sequencing Primer
(F):5'- AAGATGTCCGTCAGGTATCGGTAC -3'
(R):5'- GGCTCTGTTCACCTAGTTCATCAG -3'
Posted On2016-10-26