Incidental Mutation 'R5584:Fstl5'
ID438605
Institutional Source Beutler Lab
Gene Symbol Fstl5
Ensembl Gene ENSMUSG00000034098
Gene Namefollistatin-like 5
Synonyms9130207J01Rik
MMRRC Submission 043138-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R5584 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location76074270-76710019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76322267 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 125 (I125N)
Ref Sequence ENSEMBL: ENSMUSP00000125393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038364] [ENSMUST00000160261]
Predicted Effect probably damaging
Transcript: ENSMUST00000038364
AA Change: I125N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038506
Gene: ENSMUSG00000034098
AA Change: I125N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
KAZAL 88 133 2.16e-9 SMART
IGc2 261 328 1.11e-5 SMART
IGc2 353 420 3.85e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159686
Predicted Effect probably damaging
Transcript: ENSMUST00000160261
AA Change: I125N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125393
Gene: ENSMUSG00000034098
AA Change: I125N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
KAZAL 88 133 2.16e-9 SMART
IGc2 261 328 1.11e-5 SMART
IGc2 353 420 3.85e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,405,267 G5496D probably damaging Het
Akr1c19 A T 13: 4,243,032 Q262H probably damaging Het
Cntn5 T C 9: 9,661,452 T1070A possibly damaging Het
Efcab14 T C 4: 115,764,597 V358A possibly damaging Het
Epb41l4a G T 18: 33,854,271 T351N probably damaging Het
Etaa1 A T 11: 17,947,406 V237E possibly damaging Het
Ezh2 A T 6: 47,532,016 N684K probably damaging Het
Flnc A G 6: 29,446,628 T946A probably damaging Het
Gcsam A C 16: 45,619,863 I90L probably benign Het
Glrx T A 13: 75,847,222 I87N probably benign Het
Hivep1 T A 13: 42,160,117 N1944K probably benign Het
Lrp2 T C 2: 69,451,288 D3913G probably damaging Het
Ltb4r1 T A 14: 55,767,387 M49K possibly damaging Het
Mbip A G 12: 56,335,862 I273T probably damaging Het
Mis18bp1 A T 12: 65,154,776 S384T probably damaging Het
Nlrp4e T G 7: 23,321,177 I363S probably benign Het
Nrg3 CCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGC 14: 39,472,697 probably benign Het
Pcdha11 C A 18: 37,006,765 D482E probably damaging Het
Plppr3 T C 10: 79,866,452 Y262C probably damaging Het
Ppip5k2 T C 1: 97,750,641 K284E probably damaging Het
Rabggta T C 14: 55,720,832 N124S probably benign Het
Rbm46 C A 3: 82,864,158 M383I probably benign Het
Rfx1 G A 8: 84,088,077 probably null Het
Sema3d T C 5: 12,566,008 V493A possibly damaging Het
Sema3d T C 5: 12,570,987 V520A possibly damaging Het
Sis C G 3: 72,910,415 W1488C probably damaging Het
Slc6a20a A G 9: 123,640,688 F411S probably damaging Het
Srcap T A 7: 127,528,479 N405K probably damaging Het
Thnsl1 C T 2: 21,213,412 P138L probably damaging Het
Trim27 T A 13: 21,192,549 I489N probably damaging Het
Triobp G A 15: 78,968,132 V829I possibly damaging Het
Unc119 A G 11: 78,348,570 D217G probably damaging Het
Ushbp1 T C 8: 71,390,979 T272A possibly damaging Het
Zfpm2 A T 15: 41,102,537 N806I probably benign Het
Znrf3 T C 11: 5,286,218 E164G probably damaging Het
Other mutations in Fstl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01632:Fstl5 APN 3 76707828 missense probably benign 0.30
IGL01658:Fstl5 APN 3 76482255 missense possibly damaging 0.70
IGL01917:Fstl5 APN 3 76707846 missense probably damaging 1.00
IGL02073:Fstl5 APN 3 76659652 splice site probably benign
IGL02329:Fstl5 APN 3 76588995 missense probably damaging 1.00
IGL02651:Fstl5 APN 3 76593534 missense probably damaging 1.00
IGL02967:Fstl5 APN 3 76322191 missense probably damaging 1.00
IGL03004:Fstl5 APN 3 76648431 splice site probably benign
IGL03107:Fstl5 APN 3 76536311 missense probably damaging 1.00
IGL03113:Fstl5 APN 3 76429792 nonsense probably null
P0038:Fstl5 UTSW 3 76145062 missense probably damaging 1.00
PIT4131001:Fstl5 UTSW 3 76659699 missense probably damaging 0.99
R0015:Fstl5 UTSW 3 76322191 missense probably damaging 1.00
R0015:Fstl5 UTSW 3 76322191 missense probably damaging 1.00
R0032:Fstl5 UTSW 3 76648435 splice site probably benign
R0032:Fstl5 UTSW 3 76648435 splice site probably benign
R0078:Fstl5 UTSW 3 76659645 splice site probably benign
R0137:Fstl5 UTSW 3 76707479 missense probably damaging 1.00
R0183:Fstl5 UTSW 3 76322272 missense possibly damaging 0.86
R0330:Fstl5 UTSW 3 76707753 missense possibly damaging 0.80
R0427:Fstl5 UTSW 3 76707727 nonsense probably null
R0687:Fstl5 UTSW 3 76707812 missense possibly damaging 0.62
R1642:Fstl5 UTSW 3 76410622 missense possibly damaging 0.80
R1765:Fstl5 UTSW 3 76593476 missense possibly damaging 0.90
R1900:Fstl5 UTSW 3 76708160 missense probably damaging 1.00
R1996:Fstl5 UTSW 3 76707834 missense probably benign 0.19
R2157:Fstl5 UTSW 3 76708065 missense possibly damaging 0.46
R2228:Fstl5 UTSW 3 76482352 missense probably damaging 1.00
R2851:Fstl5 UTSW 3 76429738 splice site probably benign
R4021:Fstl5 UTSW 3 76628975 missense probably benign 0.00
R4086:Fstl5 UTSW 3 76648286 missense probably damaging 1.00
R4777:Fstl5 UTSW 3 76593500 missense probably damaging 1.00
R4829:Fstl5 UTSW 3 76322182 missense probably damaging 1.00
R4934:Fstl5 UTSW 3 76588965 missense probably damaging 1.00
R4955:Fstl5 UTSW 3 76223876 critical splice donor site probably null
R4977:Fstl5 UTSW 3 76410494 nonsense probably null
R5166:Fstl5 UTSW 3 76628960 missense possibly damaging 0.86
R5232:Fstl5 UTSW 3 76144977 missense possibly damaging 0.89
R5313:Fstl5 UTSW 3 76593505 missense possibly damaging 0.90
R5647:Fstl5 UTSW 3 76589092 missense probably damaging 1.00
R5842:Fstl5 UTSW 3 76322283 missense possibly damaging 0.94
R5978:Fstl5 UTSW 3 76145085 missense probably damaging 1.00
R6007:Fstl5 UTSW 3 76410592 missense probably damaging 1.00
R6064:Fstl5 UTSW 3 76322298 missense probably benign 0.13
R6327:Fstl5 UTSW 3 76707801 missense probably benign 0.31
R6386:Fstl5 UTSW 3 76322066 missense probably benign 0.13
R6523:Fstl5 UTSW 3 76536334 missense probably benign 0.00
R6852:Fstl5 UTSW 3 76707855 missense probably damaging 1.00
R6861:Fstl5 UTSW 3 76322216 missense probably damaging 1.00
R6866:Fstl5 UTSW 3 76322225 missense probably damaging 0.99
R7100:Fstl5 UTSW 3 76536293 missense probably benign 0.11
R7341:Fstl5 UTSW 3 76482397 splice site probably null
R7495:Fstl5 UTSW 3 76707792 missense possibly damaging 0.85
R7558:Fstl5 UTSW 3 76429785 missense possibly damaging 0.95
R7731:Fstl5 UTSW 3 76661762 missense probably damaging 1.00
R7787:Fstl5 UTSW 3 76429824 missense probably damaging 1.00
R7852:Fstl5 UTSW 3 76707968 missense probably benign 0.00
R7874:Fstl5 UTSW 3 76661786 missense probably benign 0.10
R7881:Fstl5 UTSW 3 76536298 missense probably damaging 1.00
R7935:Fstl5 UTSW 3 76707968 missense probably benign 0.00
R7957:Fstl5 UTSW 3 76661786 missense probably benign 0.10
R7964:Fstl5 UTSW 3 76536298 missense probably damaging 1.00
R8039:Fstl5 UTSW 3 76648418 missense possibly damaging 0.69
R8050:Fstl5 UTSW 3 76707503 missense probably benign 0.00
Z1176:Fstl5 UTSW 3 76707982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAAATAAGTACTGTGGCTTGGG -3'
(R):5'- TGGCCAGCTTTAGTCTCATAAATG -3'

Sequencing Primer
(F):5'- GGGAGGCACTGTGTTATCAAC -3'
(R):5'- CCATACACTACTGAATTTTGGGTTTG -3'
Posted On2016-10-26