Incidental Mutation 'R5584:Rfx1'
ID438617
Institutional Source Beutler Lab
Gene Symbol Rfx1
Ensembl Gene ENSMUSG00000031706
Gene Nameregulatory factor X, 1 (influences HLA class II expression)
Synonyms
MMRRC Submission 043138-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5584 (G1)
Quality Score168
Status Not validated
Chromosome8
Chromosomal Location84066834-84096992 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 84088077 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005600] [ENSMUST00000211046]
Predicted Effect probably null
Transcript: ENSMUST00000005600
SMART Domains Protein: ENSMUSP00000005600
Gene: ENSMUSG00000031706

DomainStartEndE-ValueType
low complexity region 11 47 N/A INTRINSIC
low complexity region 53 67 N/A INTRINSIC
low complexity region 73 92 N/A INTRINSIC
Pfam:RFX1_trans_act 106 176 9.6e-9 PFAM
Pfam:RFX1_trans_act 211 366 1.8e-59 PFAM
Pfam:RFX_DNA_binding 420 498 2.5e-35 PFAM
Blast:HisKA 705 768 3e-28 BLAST
low complexity region 908 920 N/A INTRINSIC
low complexity region 932 948 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210660
Predicted Effect probably null
Transcript: ENSMUST00000211046
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulatory factor X (RFX) family of transcription factors, which are characterized by a winged-helix DNA-binding domain. The encoded transcription factor contains an N-terminal activation domain and a C-terminal repression domain, and may activate or repress target gene expression depending on cellular context. This transcription factor has been shown to regulate a wide variety of genes involved in immunity and cancer, including the MHC class II genes and genes that may be involved in cancer progression. This gene exhibits altered expression in glioblastoma and the autoimmune disease systemic lupus erythematosis (SLE). [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,405,267 G5496D probably damaging Het
Akr1c19 A T 13: 4,243,032 Q262H probably damaging Het
Cntn5 T C 9: 9,661,452 T1070A possibly damaging Het
Efcab14 T C 4: 115,764,597 V358A possibly damaging Het
Epb41l4a G T 18: 33,854,271 T351N probably damaging Het
Etaa1 A T 11: 17,947,406 V237E possibly damaging Het
Ezh2 A T 6: 47,532,016 N684K probably damaging Het
Flnc A G 6: 29,446,628 T946A probably damaging Het
Fstl5 T A 3: 76,322,267 I125N probably damaging Het
Gcsam A C 16: 45,619,863 I90L probably benign Het
Glrx T A 13: 75,847,222 I87N probably benign Het
Hivep1 T A 13: 42,160,117 N1944K probably benign Het
Lrp2 T C 2: 69,451,288 D3913G probably damaging Het
Ltb4r1 T A 14: 55,767,387 M49K possibly damaging Het
Mbip A G 12: 56,335,862 I273T probably damaging Het
Mis18bp1 A T 12: 65,154,776 S384T probably damaging Het
Nlrp4e T G 7: 23,321,177 I363S probably benign Het
Nrg3 CCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGC 14: 39,472,697 probably benign Het
Pcdha11 C A 18: 37,006,765 D482E probably damaging Het
Plppr3 T C 10: 79,866,452 Y262C probably damaging Het
Ppip5k2 T C 1: 97,750,641 K284E probably damaging Het
Rabggta T C 14: 55,720,832 N124S probably benign Het
Rbm46 C A 3: 82,864,158 M383I probably benign Het
Sema3d T C 5: 12,566,008 V493A possibly damaging Het
Sema3d T C 5: 12,570,987 V520A possibly damaging Het
Sis C G 3: 72,910,415 W1488C probably damaging Het
Slc6a20a A G 9: 123,640,688 F411S probably damaging Het
Srcap T A 7: 127,528,479 N405K probably damaging Het
Thnsl1 C T 2: 21,213,412 P138L probably damaging Het
Trim27 T A 13: 21,192,549 I489N probably damaging Het
Triobp G A 15: 78,968,132 V829I possibly damaging Het
Unc119 A G 11: 78,348,570 D217G probably damaging Het
Ushbp1 T C 8: 71,390,979 T272A possibly damaging Het
Zfpm2 A T 15: 41,102,537 N806I probably benign Het
Znrf3 T C 11: 5,286,218 E164G probably damaging Het
Other mutations in Rfx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01612:Rfx1 APN 8 84092972 critical splice acceptor site probably null
IGL01779:Rfx1 APN 8 84092662 splice site probably benign
IGL02505:Rfx1 APN 8 84095809 missense possibly damaging 0.79
IGL02741:Rfx1 APN 8 84095842 missense possibly damaging 0.94
R1565:Rfx1 UTSW 8 84073946 missense probably benign
R1793:Rfx1 UTSW 8 84066421 unclassified probably benign
R1808:Rfx1 UTSW 8 84095048 missense probably damaging 1.00
R1971:Rfx1 UTSW 8 84095497 missense probably damaging 1.00
R4542:Rfx1 UTSW 8 84090237 missense probably damaging 1.00
R4690:Rfx1 UTSW 8 84082745 missense possibly damaging 0.50
R4995:Rfx1 UTSW 8 84080114 splice site probably null
R5163:Rfx1 UTSW 8 84093211 missense probably damaging 0.98
R5212:Rfx1 UTSW 8 84066592 unclassified probably benign
R5227:Rfx1 UTSW 8 84074058 missense probably damaging 0.99
R5401:Rfx1 UTSW 8 84066376 splice site probably null
R5431:Rfx1 UTSW 8 84082720 nonsense probably null
R5693:Rfx1 UTSW 8 84073904 missense unknown
R6210:Rfx1 UTSW 8 84093018 missense probably damaging 1.00
R6715:Rfx1 UTSW 8 84095815 missense possibly damaging 0.49
R6920:Rfx1 UTSW 8 84095488 missense probably damaging 1.00
R7131:Rfx1 UTSW 8 84095079 missense probably damaging 0.96
R7155:Rfx1 UTSW 8 84094826 missense probably damaging 0.99
R7336:Rfx1 UTSW 8 84073756 start gained probably benign
R7467:Rfx1 UTSW 8 84073913 missense possibly damaging 0.86
R8105:Rfx1 UTSW 8 84087876 missense possibly damaging 0.92
R8145:Rfx1 UTSW 8 84074028 missense probably benign 0.06
R8261:Rfx1 UTSW 8 84092850 missense probably benign 0.00
R8263:Rfx1 UTSW 8 84094854 missense probably damaging 1.00
R8443:Rfx1 UTSW 8 84079886 missense probably benign 0.00
R8680:Rfx1 UTSW 8 84091455 missense possibly damaging 0.82
Z1177:Rfx1 UTSW 8 84090277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATTGTCGCCAGCTCATCC -3'
(R):5'- GCTTCACATAGCAGCTGAGGTAC -3'

Sequencing Primer
(F):5'- TCATCCAGCAGCGAGGC -3'
(R):5'- TATGCCTTGGGCCAAACT -3'
Posted On2016-10-26