Mutagenetix > Incidental Mutation

Incidental Mutation 'R5584:Rfx1'

438617

Institutional Source

Beutler Lab

Gene Symbol

Rfx1

Ensembl Gene

ENSMUSG00000031706

Gene Name

regulatory factor X, 1 (influences HLA class II expression)

Synonyms

MMRRC Submission

043138-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5584 (G1)

Quality Score

168

Status

Not validated

Chromosome

Chromosomal Location

84066834-84096992 bp(+) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to A at 84088077 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000147677 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005600] [ENSMUST00000211046]

AlphaFold

P48377

Predicted Effect

probably null
Transcript: ENSMUST00000005600

SMART Domains

Protein: ENSMUSP00000005600
Gene: ENSMUSG00000031706

Domain	Start	End	E-Value	Type
low complexity region	11	47	N/A	INTRINSIC
low complexity region	53	67	N/A	INTRINSIC
low complexity region	73	92	N/A	INTRINSIC
Pfam:RFX1_trans_act	106	176	9.6e-9	PFAM
Pfam:RFX1_trans_act	211	366	1.8e-59	PFAM
Pfam:RFX_DNA_binding	420	498	2.5e-35	PFAM
Blast:HisKA	705	768	3e-28	BLAST
low complexity region	908	920	N/A	INTRINSIC
low complexity region	932	948	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000102190

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209362

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210660

Predicted Effect

probably null
Transcript: ENSMUST00000211046

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 98.9%
20x: 97.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulatory factor X (RFX) family of transcription factors, which are characterized by a winged-helix DNA-binding domain. The encoded transcription factor contains an N-terminal activation domain and a C-terminal repression domain, and may activate or repress target gene expression depending on cellular context. This transcription factor has been shown to regulate a wide variety of genes involved in immunity and cancer, including the MHC class II genes and genes that may be involved in cancer progression. This gene exhibits altered expression in glioblastoma and the autoimmune disease systemic lupus erythematosis (SLE). [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	C	T	13: 81,405,267	G5496D	probably damaging	Het
Akr1c19	A	T	13: 4,243,032	Q262H	probably damaging	Het
Cntn5	T	C	9: 9,661,452	T1070A	possibly damaging	Het
Efcab14	T	C	4: 115,764,597	V358A	possibly damaging	Het
Epb41l4a	G	T	18: 33,854,271	T351N	probably damaging	Het
Etaa1	A	T	11: 17,947,406	V237E	possibly damaging	Het
Ezh2	A	T	6: 47,532,016	N684K	probably damaging	Het
Flnc	A	G	6: 29,446,628	T946A	probably damaging	Het
Fstl5	T	A	3: 76,322,267	I125N	probably damaging	Het
Gcsam	A	C	16: 45,619,863	I90L	probably benign	Het
Glrx	T	A	13: 75,847,222	I87N	probably benign	Het
Hivep1	T	A	13: 42,160,117	N1944K	probably benign	Het
Lrp2	T	C	2: 69,451,288	D3913G	probably damaging	Het
Ltb4r1	T	A	14: 55,767,387	M49K	possibly damaging	Het
Mbip	A	G	12: 56,335,862	I273T	probably damaging	Het
Mis18bp1	A	T	12: 65,154,776	S384T	probably damaging	Het
Nlrp4e	T	G	7: 23,321,177	I363S	probably benign	Het
Nrg3	CCCGCCGCCGCCGCCGCCGC	CCCGCCGCCGCCGCCGC	14: 39,472,697		probably benign	Het
Pcdha11	C	A	18: 37,006,765	D482E	probably damaging	Het
Plppr3	T	C	10: 79,866,452	Y262C	probably damaging	Het
Ppip5k2	T	C	1: 97,750,641	K284E	probably damaging	Het
Rabggta	T	C	14: 55,720,832	N124S	probably benign	Het
Rbm46	C	A	3: 82,864,158	M383I	probably benign	Het
Sema3d	T	C	5: 12,566,008	V493A	possibly damaging	Het
Sema3d	T	C	5: 12,570,987	V520A	possibly damaging	Het
Sis	C	G	3: 72,910,415	W1488C	probably damaging	Het
Slc6a20a	A	G	9: 123,640,688	F411S	probably damaging	Het
Srcap	T	A	7: 127,528,479	N405K	probably damaging	Het
Thnsl1	C	T	2: 21,213,412	P138L	probably damaging	Het
Trim27	T	A	13: 21,192,549	I489N	probably damaging	Het
Triobp	G	A	15: 78,968,132	V829I	possibly damaging	Het
Unc119	A	G	11: 78,348,570	D217G	probably damaging	Het
Ushbp1	T	C	8: 71,390,979	T272A	possibly damaging	Het
Zfpm2	A	T	15: 41,102,537	N806I	probably benign	Het
Znrf3	T	C	11: 5,286,218	E164G	probably damaging	Het

Other mutations in Rfx1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01612:Rfx1	APN	8	84092972	critical splice acceptor site	probably null
IGL01779:Rfx1	APN	8	84092662	splice site	probably benign
IGL02505:Rfx1	APN	8	84095809	missense	possibly damaging	0.79
IGL02741:Rfx1	APN	8	84095842	missense	possibly damaging	0.94
R1565:Rfx1	UTSW	8	84073946	missense	probably benign
R1793:Rfx1	UTSW	8	84066421	unclassified	probably benign
R1808:Rfx1	UTSW	8	84095048	missense	probably damaging	1.00
R1971:Rfx1	UTSW	8	84095497	missense	probably damaging	1.00
R4542:Rfx1	UTSW	8	84090237	missense	probably damaging	1.00
R4690:Rfx1	UTSW	8	84082745	missense	possibly damaging	0.50
R4995:Rfx1	UTSW	8	84080114	splice site	probably null
R5163:Rfx1	UTSW	8	84093211	missense	probably damaging	0.98
R5212:Rfx1	UTSW	8	84066592	unclassified	probably benign
R5227:Rfx1	UTSW	8	84074058	missense	probably damaging	0.99
R5401:Rfx1	UTSW	8	84066376	splice site	probably null
R5431:Rfx1	UTSW	8	84082720	nonsense	probably null
R5693:Rfx1	UTSW	8	84073904	missense	unknown
R6210:Rfx1	UTSW	8	84093018	missense	probably damaging	1.00
R6715:Rfx1	UTSW	8	84095815	missense	possibly damaging	0.49
R6920:Rfx1	UTSW	8	84095488	missense	probably damaging	1.00
R7131:Rfx1	UTSW	8	84095079	missense	probably damaging	0.96
R7155:Rfx1	UTSW	8	84094826	missense	probably damaging	0.99
R7336:Rfx1	UTSW	8	84073756	start gained	probably benign
R7467:Rfx1	UTSW	8	84073913	missense	possibly damaging	0.86
R8105:Rfx1	UTSW	8	84087876	missense	possibly damaging	0.92
R8145:Rfx1	UTSW	8	84074028	missense	probably benign	0.06
R8261:Rfx1	UTSW	8	84092850	missense	probably benign	0.00
R8263:Rfx1	UTSW	8	84094854	missense	probably damaging	1.00
R8443:Rfx1	UTSW	8	84079886	missense	probably benign	0.00
R8680:Rfx1	UTSW	8	84091455	missense	possibly damaging	0.82
R9302:Rfx1	UTSW	8	84091033	missense	possibly damaging	0.50
R9473:Rfx1	UTSW	8	84093274	missense	probably damaging	0.96
R9766:Rfx1	UTSW	8	84087747	missense	probably damaging	1.00
Z1177:Rfx1	UTSW	8	84090277	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAATTGTCGCCAGCTCATCC -3'
(R):5'- GCTTCACATAGCAGCTGAGGTAC -3'

Sequencing Primer
(F):5'- TCATCCAGCAGCGAGGC -3'
(R):5'- TATGCCTTGGGCCAAACT -3'

Posted On

2016-10-26