Incidental Mutation 'R5584:Rabggta'
ID438633
Institutional Source Beutler Lab
Gene Symbol Rabggta
Ensembl Gene ENSMUSG00000040472
Gene NameRab geranylgeranyl transferase, a subunit
Synonyms
MMRRC Submission 043138-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R5584 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55715416-55722263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55720832 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 124 (N124S)
Ref Sequence ENSEMBL: ENSMUSP00000154725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062861] [ENSMUST00000163889] [ENSMUST00000169237] [ENSMUST00000227061]
Predicted Effect probably benign
Transcript: ENSMUST00000062861
SMART Domains Protein: ENSMUSP00000061498
Gene: ENSMUSG00000040472

DomainStartEndE-ValueType
Pfam:PPTA 47 77 2.9e-8 PFAM
Pfam:PPTA 91 121 2e-12 PFAM
Pfam:PPTA 127 156 7.6e-11 PFAM
Pfam:PPTA 162 192 3.8e-12 PFAM
Pfam:PPTA 210 240 7.8e-12 PFAM
Pfam:RabGGT_insert 243 346 5.3e-47 PFAM
LRR 462 485 1.62e0 SMART
LRR 507 531 1.03e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163889
AA Change: N124S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128668
Gene: ENSMUSG00000040472
AA Change: N124S

DomainStartEndE-ValueType
Pfam:PPTA 47 77 2.9e-8 PFAM
Pfam:PPTA 91 121 2e-12 PFAM
Pfam:PPTA 127 156 7.6e-11 PFAM
Pfam:PPTA 162 192 3.8e-12 PFAM
Pfam:PPTA 210 240 7.8e-12 PFAM
Pfam:RabGGT_insert 243 346 5.3e-47 PFAM
LRR 462 485 1.62e0 SMART
LRR 507 531 1.03e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169237
AA Change: N124S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133032
Gene: ENSMUSG00000040472
AA Change: N124S

DomainStartEndE-ValueType
Pfam:PPTA 92 119 3.6e-12 PFAM
Pfam:PPTA 128 154 1.2e-10 PFAM
Pfam:PPTA 163 190 2e-11 PFAM
Pfam:PPTA 211 238 9e-12 PFAM
Pfam:RabGGT_insert 244 346 1.9e-46 PFAM
LRR 462 485 1.62e0 SMART
LRR 507 531 1.03e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226209
Predicted Effect probably benign
Transcript: ENSMUST00000227061
AA Change: N124S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228899
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes exhibit diluted pigmentation, a platelet defect resulting in prolonged bleeding, macrothrombocytopenia, impaired killing by cytotoxic T lymphocytes, high mortality, and poor breeding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,405,267 G5496D probably damaging Het
Akr1c19 A T 13: 4,243,032 Q262H probably damaging Het
Cntn5 T C 9: 9,661,452 T1070A possibly damaging Het
Efcab14 T C 4: 115,764,597 V358A possibly damaging Het
Epb41l4a G T 18: 33,854,271 T351N probably damaging Het
Etaa1 A T 11: 17,947,406 V237E possibly damaging Het
Ezh2 A T 6: 47,532,016 N684K probably damaging Het
Flnc A G 6: 29,446,628 T946A probably damaging Het
Fstl5 T A 3: 76,322,267 I125N probably damaging Het
Gcsam A C 16: 45,619,863 I90L probably benign Het
Glrx T A 13: 75,847,222 I87N probably benign Het
Hivep1 T A 13: 42,160,117 N1944K probably benign Het
Lrp2 T C 2: 69,451,288 D3913G probably damaging Het
Ltb4r1 T A 14: 55,767,387 M49K possibly damaging Het
Mbip A G 12: 56,335,862 I273T probably damaging Het
Mis18bp1 A T 12: 65,154,776 S384T probably damaging Het
Nlrp4e T G 7: 23,321,177 I363S probably benign Het
Nrg3 CCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGC 14: 39,472,697 probably benign Het
Pcdha11 C A 18: 37,006,765 D482E probably damaging Het
Plppr3 T C 10: 79,866,452 Y262C probably damaging Het
Ppip5k2 T C 1: 97,750,641 K284E probably damaging Het
Rbm46 C A 3: 82,864,158 M383I probably benign Het
Rfx1 G A 8: 84,088,077 probably null Het
Sema3d T C 5: 12,566,008 V493A possibly damaging Het
Sema3d T C 5: 12,570,987 V520A possibly damaging Het
Sis C G 3: 72,910,415 W1488C probably damaging Het
Slc6a20a A G 9: 123,640,688 F411S probably damaging Het
Srcap T A 7: 127,528,479 N405K probably damaging Het
Thnsl1 C T 2: 21,213,412 P138L probably damaging Het
Trim27 T A 13: 21,192,549 I489N probably damaging Het
Triobp G A 15: 78,968,132 V829I possibly damaging Het
Unc119 A G 11: 78,348,570 D217G probably damaging Het
Ushbp1 T C 8: 71,390,979 T272A possibly damaging Het
Zfpm2 A T 15: 41,102,537 N806I probably benign Het
Znrf3 T C 11: 5,286,218 E164G probably damaging Het
Other mutations in Rabggta
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01876:Rabggta APN 14 55718671 missense probably damaging 0.98
IGL02263:Rabggta APN 14 55718961 splice site probably benign
IGL02293:Rabggta APN 14 55721696 missense probably benign 0.27
IGL02377:Rabggta APN 14 55718495 missense possibly damaging 0.66
IGL02901:Rabggta APN 14 55721681 missense probably benign 0.41
IGL03004:Rabggta APN 14 55719230 splice site probably benign
R0334:Rabggta UTSW 14 55720811 missense probably damaging 1.00
R1914:Rabggta UTSW 14 55721189 missense possibly damaging 0.73
R2926:Rabggta UTSW 14 55719290 missense probably benign 0.00
R4469:Rabggta UTSW 14 55716487 missense probably benign 0.00
R6721:Rabggta UTSW 14 55717203 missense probably damaging 1.00
R6960:Rabggta UTSW 14 55721842 critical splice donor site probably null
R7169:Rabggta UTSW 14 55720901 missense probably damaging 0.99
R7447:Rabggta UTSW 14 55719316 missense probably null 0.11
R7805:Rabggta UTSW 14 55719512 missense probably benign 0.00
R8038:Rabggta UTSW 14 55718930 missense probably benign 0.07
R8422:Rabggta UTSW 14 55718458 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GCCCTAGCAATTCCTCCATG -3'
(R):5'- TGTTGGAAGGCTCTAACCCC -3'

Sequencing Primer
(F):5'- AGACTGCTCCTATACATACATCTGG -3'
(R):5'- CCCTTTCTCTTGGGGTCCAGG -3'
Posted On2016-10-26