Incidental Mutation 'R5584:Zfpm2'
ID438635
Institutional Source Beutler Lab
Gene Symbol Zfpm2
Ensembl Gene ENSMUSG00000022306
Gene Namezinc finger protein, multitype 2
SynonymsB330005D23Rik, FOG2, FOG-2
MMRRC Submission 043138-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5584 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location40655035-41104592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41102537 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 806 (N806I)
Ref Sequence ENSEMBL: ENSMUSP00000051335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]
Predicted Effect probably benign
Transcript: ENSMUST00000053467
AA Change: N806I

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: N806I

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
ZnF_C2H2 250 270 4.27e1 SMART
ZnF_C2H2 296 320 1.25e-1 SMART
ZnF_C2H2 335 357 4.05e-1 SMART
ZnF_C2H2 363 385 6.23e-2 SMART
ZnF_C2H2 548 569 1.43e1 SMART
ZnF_C2H2 687 714 1.06e2 SMART
low complexity region 731 741 N/A INTRINSIC
ZnF_C2H2 854 874 5.4e1 SMART
ZnF_C2H2 1119 1145 4.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000230319
AA Change: N674I

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,405,267 G5496D probably damaging Het
Akr1c19 A T 13: 4,243,032 Q262H probably damaging Het
Cntn5 T C 9: 9,661,452 T1070A possibly damaging Het
Efcab14 T C 4: 115,764,597 V358A possibly damaging Het
Epb41l4a G T 18: 33,854,271 T351N probably damaging Het
Etaa1 A T 11: 17,947,406 V237E possibly damaging Het
Ezh2 A T 6: 47,532,016 N684K probably damaging Het
Flnc A G 6: 29,446,628 T946A probably damaging Het
Fstl5 T A 3: 76,322,267 I125N probably damaging Het
Gcsam A C 16: 45,619,863 I90L probably benign Het
Glrx T A 13: 75,847,222 I87N probably benign Het
Hivep1 T A 13: 42,160,117 N1944K probably benign Het
Lrp2 T C 2: 69,451,288 D3913G probably damaging Het
Ltb4r1 T A 14: 55,767,387 M49K possibly damaging Het
Mbip A G 12: 56,335,862 I273T probably damaging Het
Mis18bp1 A T 12: 65,154,776 S384T probably damaging Het
Nlrp4e T G 7: 23,321,177 I363S probably benign Het
Nrg3 CCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGC 14: 39,472,697 probably benign Het
Pcdha11 C A 18: 37,006,765 D482E probably damaging Het
Plppr3 T C 10: 79,866,452 Y262C probably damaging Het
Ppip5k2 T C 1: 97,750,641 K284E probably damaging Het
Rabggta T C 14: 55,720,832 N124S probably benign Het
Rbm46 C A 3: 82,864,158 M383I probably benign Het
Rfx1 G A 8: 84,088,077 probably null Het
Sema3d T C 5: 12,566,008 V493A possibly damaging Het
Sema3d T C 5: 12,570,987 V520A possibly damaging Het
Sis C G 3: 72,910,415 W1488C probably damaging Het
Slc6a20a A G 9: 123,640,688 F411S probably damaging Het
Srcap T A 7: 127,528,479 N405K probably damaging Het
Thnsl1 C T 2: 21,213,412 P138L probably damaging Het
Trim27 T A 13: 21,192,549 I489N probably damaging Het
Triobp G A 15: 78,968,132 V829I possibly damaging Het
Unc119 A G 11: 78,348,570 D217G probably damaging Het
Ushbp1 T C 8: 71,390,979 T272A possibly damaging Het
Znrf3 T C 11: 5,286,218 E164G probably damaging Het
Other mutations in Zfpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Zfpm2 APN 15 41099287 missense probably damaging 1.00
IGL00815:Zfpm2 APN 15 41099491 missense probably benign 0.37
IGL00821:Zfpm2 APN 15 41103387 missense probably damaging 1.00
IGL01622:Zfpm2 APN 15 41101924 missense probably benign 0.07
IGL01623:Zfpm2 APN 15 41101924 missense probably benign 0.07
IGL01807:Zfpm2 APN 15 40753056 critical splice donor site probably null
IGL01872:Zfpm2 APN 15 41102387 missense probably benign
IGL02087:Zfpm2 APN 15 41103121 missense probably damaging 0.97
IGL02123:Zfpm2 APN 15 41102195 missense probably damaging 1.00
IGL02355:Zfpm2 APN 15 41099494 missense probably damaging 1.00
IGL02362:Zfpm2 APN 15 41099494 missense probably damaging 1.00
IGL02579:Zfpm2 APN 15 41099472 missense possibly damaging 0.91
IGL02752:Zfpm2 APN 15 41102019 missense probably benign 0.23
IGL02792:Zfpm2 APN 15 41103013 missense probably benign 0.00
IGL02861:Zfpm2 APN 15 41103266 missense probably damaging 0.98
IGL03180:Zfpm2 APN 15 41101394 missense probably damaging 1.00
IGL03344:Zfpm2 APN 15 41102774 missense probably benign
R0305:Zfpm2 UTSW 15 40774035 splice site probably benign
R0365:Zfpm2 UTSW 15 40774066 missense possibly damaging 0.88
R1171:Zfpm2 UTSW 15 41101679 missense probably damaging 1.00
R1456:Zfpm2 UTSW 15 41102481 missense probably damaging 1.00
R1482:Zfpm2 UTSW 15 41099291 missense probably damaging 1.00
R1580:Zfpm2 UTSW 15 41103209 missense possibly damaging 0.84
R2119:Zfpm2 UTSW 15 41103023 missense probably damaging 1.00
R2189:Zfpm2 UTSW 15 41101183 missense possibly damaging 0.76
R2867:Zfpm2 UTSW 15 41099389 missense probably benign 0.06
R2867:Zfpm2 UTSW 15 41099389 missense probably benign 0.06
R2886:Zfpm2 UTSW 15 41102323 missense probably benign 0.44
R3024:Zfpm2 UTSW 15 41102959 missense probably benign 0.00
R4043:Zfpm2 UTSW 15 40870627 missense possibly damaging 0.94
R4178:Zfpm2 UTSW 15 41103544 missense probably damaging 1.00
R4465:Zfpm2 UTSW 15 41096161 missense probably benign 0.00
R5263:Zfpm2 UTSW 15 41099395 missense probably benign 0.45
R5266:Zfpm2 UTSW 15 41099469 missense probably benign 0.01
R5352:Zfpm2 UTSW 15 40870542 missense probably benign 0.01
R5661:Zfpm2 UTSW 15 41096071 nonsense probably null
R6437:Zfpm2 UTSW 15 41099397 missense probably benign
R6660:Zfpm2 UTSW 15 40655585 critical splice donor site probably null
R6742:Zfpm2 UTSW 15 41101718 missense probably benign
R6749:Zfpm2 UTSW 15 40954708 missense possibly damaging 0.90
R7363:Zfpm2 UTSW 15 40753017 missense probably damaging 1.00
R7401:Zfpm2 UTSW 15 41102990 missense possibly damaging 0.87
R7657:Zfpm2 UTSW 15 41103275 missense possibly damaging 0.78
R7690:Zfpm2 UTSW 15 40954766 missense possibly damaging 0.45
R7698:Zfpm2 UTSW 15 41096091 missense probably benign 0.03
R7893:Zfpm2 UTSW 15 41102612 missense probably damaging 1.00
R8081:Zfpm2 UTSW 15 41102248 missense probably damaging 1.00
R8223:Zfpm2 UTSW 15 40752959 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TGTACGAAATGTGCCTACCTGAG -3'
(R):5'- TCTGCTTGTGCGCCAGATAG -3'

Sequencing Primer
(F):5'- CAATCCTTGTAGCTCCAC -3'
(R):5'- TGTGCGCCAGATAGTTCTCGAC -3'
Posted On2016-10-26