Mutagenetix > Incidental Mutation

Incidental Mutation 'R5585:Lrrc38'

438649

Institutional Source

Beutler Lab

Gene Symbol

Lrrc38

Ensembl Gene

ENSMUSG00000028584

Gene Name

leucine rich repeat containing 38

Synonyms

MMRRC Submission

043139-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R5585 (G1)

Quality Score

126

Status

Not validated

Chromosome

Chromosomal Location

143349757-143371032 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 143350391 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 75 (I75V)

Ref Sequence

ENSEMBL: ENSMUSP00000053597 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052458]

AlphaFold

A2VDH3

Predicted Effect

probably damaging
Transcript: ENSMUST00000052458
AA Change: I75V

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000053597
Gene: ENSMUSG00000028584
AA Change: I75V

Domain	Start	End	E-Value	Type
low complexity region	12	27	N/A	INTRINSIC
LRRNT	31	64	2.82e-4	SMART
LRR	84	106	1.37e1	SMART
LRR	108	130	5.26e0	SMART
LRR	132	154	2.27e1	SMART
LRR	155	178	8.09e-1	SMART
LRRCT	190	244	8.63e-6	SMART
transmembrane domain	252	274	N/A	INTRINSIC
low complexity region	288	298	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600014C23Rik	A	T	17: 45,733,744	I17N	unknown	Het
4932414N04Rik	A	G	2: 68,741,426	T549A	probably benign	Het
9330159F19Rik	C	A	10: 29,225,275	S548Y	possibly damaging	Het
Aanat	A	G	11: 116,596,973	Y166C	probably damaging	Het
Adra2a	G	T	19: 54,046,239	A9S	probably benign	Het
Ap4m1	A	G	5: 138,172,240	Y17C	probably damaging	Het
Arhgap33	T	G	7: 30,523,835	M891L	probably benign	Het
Calm5	A	G	13: 3,854,372	D22G	possibly damaging	Het
Ccdc15	C	T	9: 37,277,403	R795H	probably benign	Het
Cngb1	T	A	8: 95,263,139	I323F	probably damaging	Het
Cyp26b1	A	G	6: 84,577,189	F74L	probably damaging	Het
Dpagt1	G	A	9: 44,329,142		probably null	Het
Ercc8	C	T	13: 108,175,589	P196S	probably damaging	Het
Gm10985	A	C	3: 53,845,253	Y19S	probably damaging	Het
Hfm1	G	A	5: 106,911,439	S239L	probably benign	Het
Hgf	A	G	5: 16,564,801	D91G	possibly damaging	Het
Lefty2	T	A	1: 180,893,263	V27D	possibly damaging	Het
Lrp2	G	A	2: 69,464,624	T3450I	possibly damaging	Het
Ncor2	C	A	5: 125,067,911	E556*	probably null	Het
Nedd9	A	G	13: 41,316,474	L401P	probably damaging	Het
Nfatc4	T	C	14: 55,826,755	L163P	probably damaging	Het
Nln	T	C	13: 104,025,061	N667S	possibly damaging	Het
Olfr1153	A	G	2: 87,896,675	T159A	possibly damaging	Het
Pnpla8	T	C	12: 44,283,064	I133T	probably benign	Het
Psma1	C	T	7: 114,274,067	G12S	probably damaging	Het
Psmd3	G	A	11: 98,682,881	G51D	possibly damaging	Het
Ptprb	A	G	10: 116,380,854	Q1959R	probably damaging	Het
Rhbdf1	A	G	11: 32,210,222		probably null	Het
Rnf167	T	C	11: 70,649,482	V110A	probably damaging	Het
Rrp9	C	T	9: 106,485,326	S470F	probably benign	Het
Rtn3	G	A	19: 7,458,195	P125L	probably benign	Het
Scube1	C	T	15: 83,676,923	C156Y	probably damaging	Het
Tgm2	A	T	2: 158,131,455	Y245*	probably null	Het
Timeless	T	C	10: 128,240,243	I68T	probably damaging	Het
Ttn	A	G	2: 76,814,710	S12934P	probably damaging	Het
Vwa5b2	T	A	16: 20,594,678	Y214*	probably null	Het
Yars2	T	A	16: 16,304,620	N7K	probably damaging	Het
Zfp142	G	A	1: 74,578,245	Q150*	probably null	Het
Zfp995	C	T	17: 21,887,358		probably benign	Het

Other mutations in Lrrc38

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0281:Lrrc38	UTSW	4	143350409	missense	probably damaging	0.99
R0545:Lrrc38	UTSW	4	143350758	missense	probably benign	0.41
R1078:Lrrc38	UTSW	4	143350518	missense	probably benign	0.06
R1467:Lrrc38	UTSW	4	143369880	missense	probably damaging	1.00
R1467:Lrrc38	UTSW	4	143369880	missense	probably damaging	1.00
R1967:Lrrc38	UTSW	4	143369983	missense	unknown
R2221:Lrrc38	UTSW	4	143369849	nonsense	probably null
R2223:Lrrc38	UTSW	4	143369849	nonsense	probably null
R4061:Lrrc38	UTSW	4	143350506	missense	probably damaging	1.00
R4930:Lrrc38	UTSW	4	143369868	missense	probably damaging	0.98
R6787:Lrrc38	UTSW	4	143369794	missense	probably benign	0.18
R7046:Lrrc38	UTSW	4	143350169	start codon destroyed	probably null
R7706:Lrrc38	UTSW	4	143350275	missense	probably damaging	1.00
R8189:Lrrc38	UTSW	4	143350733	missense	probably damaging	1.00
R8190:Lrrc38	UTSW	4	143350733	missense	probably damaging	1.00
R8192:Lrrc38	UTSW	4	143350733	missense	probably damaging	1.00
R8219:Lrrc38	UTSW	4	143350733	missense	probably damaging	1.00
R8221:Lrrc38	UTSW	4	143350733	missense	probably damaging	1.00
R8223:Lrrc38	UTSW	4	143350733	missense	probably damaging	1.00
R8226:Lrrc38	UTSW	4	143350733	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTTCCTGTGCGGGTAAATTC -3'
(R):5'- TCATGTACACCGGCCAGATG -3'

Sequencing Primer
(F):5'- GGGTAAATTCTGCGCCCAG -3'
(R):5'- CACCGGCCAGATGGTTGTTG -3'

Posted On

2016-10-26