Incidental Mutation 'R5585:Hfm1'
ID 438652
Institutional Source Beutler Lab
Gene Symbol Hfm1
Ensembl Gene ENSMUSG00000043410
Gene Name HFM1, ATP-dependent DNA helicase homolog
Synonyms LOC381663, A330009G12Rik, Mer3, Sec63d1
MMRRC Submission 043139-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R5585 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 106988058-107074187 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 107059305 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 239 (S239L)
Ref Sequence ENSEMBL: ENSMUSP00000142727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112690] [ENSMUST00000117588] [ENSMUST00000148686] [ENSMUST00000200249]
AlphaFold D3Z4R1
Predicted Effect probably benign
Transcript: ENSMUST00000112690
AA Change: S239L

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000108310
Gene: ENSMUSG00000043410
AA Change: S239L

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000117588
AA Change: S239L

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410
AA Change: S239L

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137795
Predicted Effect probably benign
Transcript: ENSMUST00000148686
Predicted Effect probably benign
Transcript: ENSMUST00000200249
AA Change: S239L

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000142727
Gene: ENSMUSG00000043410
AA Change: S239L

DomainStartEndE-ValueType
Pfam:ResIII 260 410 9.9e-7 PFAM
Pfam:DEAD 281 410 1.5e-19 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. Defects in this gene are a cause of premature ovarian failure 9 (POF9). [provided by RefSeq, Apr 2014]
PHENOTYPE: Meiosis ais disrupted in homozygotes and bothe sexes are sterile [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik A T 17: 46,044,670 (GRCm39) I17N unknown Het
4932414N04Rik A G 2: 68,571,770 (GRCm39) T549A probably benign Het
9330159F19Rik C A 10: 29,101,271 (GRCm39) S548Y possibly damaging Het
Aanat A G 11: 116,487,799 (GRCm39) Y166C probably damaging Het
Adra2a G T 19: 54,034,670 (GRCm39) A9S probably benign Het
Ap4m1 A G 5: 138,170,502 (GRCm39) Y17C probably damaging Het
Arhgap33 T G 7: 30,223,260 (GRCm39) M891L probably benign Het
Calm5 A G 13: 3,904,372 (GRCm39) D22G possibly damaging Het
Ccdc15 C T 9: 37,188,699 (GRCm39) R795H probably benign Het
Cngb1 T A 8: 95,989,767 (GRCm39) I323F probably damaging Het
Cyp26b1 A G 6: 84,554,171 (GRCm39) F74L probably damaging Het
Dpagt1 G A 9: 44,240,439 (GRCm39) probably null Het
Ercc8 C T 13: 108,312,123 (GRCm39) P196S probably damaging Het
Gm10985 A C 3: 53,752,674 (GRCm39) Y19S probably damaging Het
Hgf A G 5: 16,769,799 (GRCm39) D91G possibly damaging Het
Lefty2 T A 1: 180,720,828 (GRCm39) V27D possibly damaging Het
Lrp2 G A 2: 69,294,968 (GRCm39) T3450I possibly damaging Het
Lrrc38 A G 4: 143,076,961 (GRCm39) I75V probably damaging Het
Ncor2 C A 5: 125,144,975 (GRCm39) E556* probably null Het
Nedd9 A G 13: 41,469,950 (GRCm39) L401P probably damaging Het
Nfatc4 T C 14: 56,064,212 (GRCm39) L163P probably damaging Het
Nln T C 13: 104,161,569 (GRCm39) N667S possibly damaging Het
Or5w20 A G 2: 87,727,019 (GRCm39) T159A possibly damaging Het
Pnpla8 T C 12: 44,329,847 (GRCm39) I133T probably benign Het
Psma1 C T 7: 113,873,302 (GRCm39) G12S probably damaging Het
Psmd3 G A 11: 98,573,707 (GRCm39) G51D possibly damaging Het
Ptprb A G 10: 116,216,759 (GRCm39) Q1959R probably damaging Het
Rhbdf1 A G 11: 32,160,222 (GRCm39) probably null Het
Rnf167 T C 11: 70,540,308 (GRCm39) V110A probably damaging Het
Rrp9 C T 9: 106,362,525 (GRCm39) S470F probably benign Het
Rtn3 G A 19: 7,435,560 (GRCm39) P125L probably benign Het
Scube1 C T 15: 83,561,124 (GRCm39) C156Y probably damaging Het
Tgm2 A T 2: 157,973,375 (GRCm39) Y245* probably null Het
Timeless T C 10: 128,076,112 (GRCm39) I68T probably damaging Het
Ttn A G 2: 76,645,054 (GRCm39) S12934P probably damaging Het
Vwa5b2 T A 16: 20,413,428 (GRCm39) Y214* probably null Het
Yars2 T A 16: 16,122,484 (GRCm39) N7K probably damaging Het
Zfp142 G A 1: 74,617,404 (GRCm39) Q150* probably null Het
Zfp995 C T 17: 22,106,339 (GRCm39) probably benign Het
Other mutations in Hfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Hfm1 APN 5 107,049,996 (GRCm39) missense possibly damaging 0.70
IGL01295:Hfm1 APN 5 107,065,472 (GRCm39) missense possibly damaging 0.46
IGL01725:Hfm1 APN 5 107,065,245 (GRCm39) missense probably benign 0.00
IGL01758:Hfm1 APN 5 107,052,659 (GRCm39) missense probably damaging 0.99
IGL01911:Hfm1 APN 5 107,059,410 (GRCm39) missense possibly damaging 0.92
IGL02337:Hfm1 APN 5 107,052,133 (GRCm39) missense possibly damaging 0.81
IGL02472:Hfm1 APN 5 107,021,794 (GRCm39) splice site probably benign
IGL02496:Hfm1 APN 5 107,049,627 (GRCm39) missense probably benign 0.00
IGL02545:Hfm1 APN 5 107,043,153 (GRCm39) missense probably damaging 1.00
IGL02584:Hfm1 APN 5 107,026,528 (GRCm39) splice site probably null
IGL02728:Hfm1 APN 5 107,026,689 (GRCm39) missense probably benign 0.13
IGL02881:Hfm1 APN 5 107,022,118 (GRCm39) missense probably damaging 1.00
IGL03108:Hfm1 APN 5 107,043,800 (GRCm39) unclassified probably benign
IGL03351:Hfm1 APN 5 107,059,441 (GRCm39) nonsense probably null
IGL03353:Hfm1 APN 5 107,004,795 (GRCm39) missense probably damaging 0.99
R0024:Hfm1 UTSW 5 107,004,790 (GRCm39) missense probably benign 0.41
R0024:Hfm1 UTSW 5 107,004,790 (GRCm39) missense probably benign 0.41
R0094:Hfm1 UTSW 5 107,065,344 (GRCm39) missense probably benign
R0633:Hfm1 UTSW 5 107,065,467 (GRCm39) missense possibly damaging 0.56
R0644:Hfm1 UTSW 5 107,046,122 (GRCm39) critical splice donor site probably null
R1078:Hfm1 UTSW 5 107,026,696 (GRCm39) missense probably damaging 1.00
R1120:Hfm1 UTSW 5 107,052,084 (GRCm39) splice site probably benign
R1166:Hfm1 UTSW 5 107,059,277 (GRCm39) missense probably benign 0.00
R1242:Hfm1 UTSW 5 107,022,767 (GRCm39) missense probably damaging 0.99
R1414:Hfm1 UTSW 5 107,020,219 (GRCm39) missense probably benign 0.01
R1450:Hfm1 UTSW 5 107,066,324 (GRCm39) missense probably damaging 0.99
R1529:Hfm1 UTSW 5 107,000,989 (GRCm39) missense probably benign 0.00
R1622:Hfm1 UTSW 5 107,041,389 (GRCm39) missense possibly damaging 0.58
R1710:Hfm1 UTSW 5 107,043,869 (GRCm39) missense probably damaging 0.96
R1710:Hfm1 UTSW 5 107,028,380 (GRCm39) missense probably damaging 1.00
R1757:Hfm1 UTSW 5 107,028,226 (GRCm39) splice site probably null
R1856:Hfm1 UTSW 5 106,995,542 (GRCm39) missense probably benign 0.00
R1984:Hfm1 UTSW 5 107,046,442 (GRCm39) missense probably damaging 0.98
R1985:Hfm1 UTSW 5 107,046,442 (GRCm39) missense probably damaging 0.98
R2040:Hfm1 UTSW 5 107,049,684 (GRCm39) missense probably damaging 1.00
R2122:Hfm1 UTSW 5 107,044,121 (GRCm39) missense probably damaging 1.00
R2426:Hfm1 UTSW 5 106,995,519 (GRCm39) splice site probably null
R2474:Hfm1 UTSW 5 107,020,282 (GRCm39) missense possibly damaging 0.81
R2926:Hfm1 UTSW 5 107,022,148 (GRCm39) nonsense probably null
R2944:Hfm1 UTSW 5 107,020,196 (GRCm39) missense probably damaging 1.00
R3705:Hfm1 UTSW 5 107,040,705 (GRCm39) unclassified probably benign
R4256:Hfm1 UTSW 5 107,052,663 (GRCm39) missense possibly damaging 0.83
R4455:Hfm1 UTSW 5 107,034,374 (GRCm39) splice site probably null
R4538:Hfm1 UTSW 5 107,022,756 (GRCm39) missense possibly damaging 0.47
R4540:Hfm1 UTSW 5 107,022,087 (GRCm39) nonsense probably null
R4591:Hfm1 UTSW 5 106,995,533 (GRCm39) missense probably benign 0.08
R4745:Hfm1 UTSW 5 107,049,709 (GRCm39) missense possibly damaging 0.87
R4747:Hfm1 UTSW 5 107,065,389 (GRCm39) missense probably benign
R4765:Hfm1 UTSW 5 106,990,405 (GRCm39) missense probably benign 0.21
R4821:Hfm1 UTSW 5 107,002,606 (GRCm39) critical splice donor site probably null
R4842:Hfm1 UTSW 5 107,040,617 (GRCm39) missense probably damaging 1.00
R4944:Hfm1 UTSW 5 107,022,079 (GRCm39) missense possibly damaging 0.46
R5093:Hfm1 UTSW 5 107,049,597 (GRCm39) missense probably damaging 1.00
R5399:Hfm1 UTSW 5 107,065,428 (GRCm39) missense possibly damaging 0.91
R5414:Hfm1 UTSW 5 107,049,942 (GRCm39) missense probably damaging 1.00
R5436:Hfm1 UTSW 5 107,040,638 (GRCm39) missense possibly damaging 0.61
R5459:Hfm1 UTSW 5 107,052,629 (GRCm39) missense probably damaging 1.00
R5485:Hfm1 UTSW 5 106,995,528 (GRCm39) critical splice donor site probably null
R5631:Hfm1 UTSW 5 107,052,629 (GRCm39) missense probably damaging 1.00
R5705:Hfm1 UTSW 5 107,059,319 (GRCm39) missense probably benign 0.21
R5804:Hfm1 UTSW 5 107,026,455 (GRCm39) splice site probably null
R5959:Hfm1 UTSW 5 107,022,783 (GRCm39) missense probably damaging 1.00
R6046:Hfm1 UTSW 5 107,046,509 (GRCm39) splice site probably null
R6191:Hfm1 UTSW 5 107,034,419 (GRCm39) missense possibly damaging 0.95
R6345:Hfm1 UTSW 5 106,989,504 (GRCm39) missense probably benign
R6580:Hfm1 UTSW 5 106,995,575 (GRCm39) missense probably benign 0.00
R6651:Hfm1 UTSW 5 106,995,553 (GRCm39) missense probably benign 0.00
R6761:Hfm1 UTSW 5 107,043,145 (GRCm39) missense probably damaging 1.00
R6835:Hfm1 UTSW 5 107,026,681 (GRCm39) nonsense probably null
R6891:Hfm1 UTSW 5 107,065,240 (GRCm39) missense possibly damaging 0.49
R6924:Hfm1 UTSW 5 106,998,276 (GRCm39) splice site probably null
R6980:Hfm1 UTSW 5 107,028,343 (GRCm39) missense probably benign 0.31
R7054:Hfm1 UTSW 5 107,043,909 (GRCm39) missense probably benign 0.01
R7058:Hfm1 UTSW 5 107,059,306 (GRCm39) missense probably benign 0.04
R7189:Hfm1 UTSW 5 107,049,569 (GRCm39) critical splice donor site probably null
R7250:Hfm1 UTSW 5 107,052,197 (GRCm39) missense probably benign 0.00
R7376:Hfm1 UTSW 5 107,043,084 (GRCm39) missense possibly damaging 0.95
R7577:Hfm1 UTSW 5 107,043,909 (GRCm39) missense probably benign 0.01
R7636:Hfm1 UTSW 5 107,065,332 (GRCm39) missense probably benign 0.02
R7639:Hfm1 UTSW 5 107,046,341 (GRCm39) missense possibly damaging 0.46
R7639:Hfm1 UTSW 5 107,037,791 (GRCm39) missense probably benign 0.03
R7763:Hfm1 UTSW 5 107,029,727 (GRCm39) missense probably damaging 1.00
R7828:Hfm1 UTSW 5 107,029,657 (GRCm39) critical splice donor site probably null
R7905:Hfm1 UTSW 5 107,046,419 (GRCm39) missense probably damaging 1.00
R8160:Hfm1 UTSW 5 107,043,899 (GRCm39) missense probably null 0.00
R8477:Hfm1 UTSW 5 107,029,684 (GRCm39) missense probably benign 0.01
R8739:Hfm1 UTSW 5 107,046,371 (GRCm39) missense probably damaging 0.96
R8968:Hfm1 UTSW 5 107,065,439 (GRCm39) missense probably benign 0.00
R9072:Hfm1 UTSW 5 107,046,146 (GRCm39) missense probably benign 0.04
R9073:Hfm1 UTSW 5 107,046,146 (GRCm39) missense probably benign 0.04
R9152:Hfm1 UTSW 5 106,989,611 (GRCm39) missense probably benign 0.01
R9234:Hfm1 UTSW 5 107,041,334 (GRCm39) missense probably benign
R9244:Hfm1 UTSW 5 107,022,766 (GRCm39) missense probably damaging 0.96
R9576:Hfm1 UTSW 5 107,021,938 (GRCm39) missense probably benign 0.00
R9649:Hfm1 UTSW 5 107,066,329 (GRCm39) missense possibly damaging 0.82
R9743:Hfm1 UTSW 5 107,022,125 (GRCm39) missense possibly damaging 0.55
R9782:Hfm1 UTSW 5 107,021,896 (GRCm39) missense probably benign 0.38
R9789:Hfm1 UTSW 5 107,065,346 (GRCm39) missense probably benign 0.00
Z1177:Hfm1 UTSW 5 107,019,686 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAGAACCTAAGCCATTTGGGG -3'
(R):5'- ACTTGAGTTCTCATATCAGCCCAG -3'

Sequencing Primer
(F):5'- CACTTTCCATAAAAAGCTCCAATAAC -3'
(R):5'- GAGTTCTCATATCAGCCCAGTGAAAC -3'
Posted On 2016-10-26