Incidental Mutation 'R5585:Psma1'
ID438657
Institutional Source Beutler Lab
Gene Symbol Psma1
Ensembl Gene ENSMUSG00000030751
Gene Nameproteasome (prosome, macropain) subunit, alpha type 1
SynonymsC2, HC2, Pros-30
MMRRC Submission 043139-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.638) question?
Stock #R5585 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location114264606-114276118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 114274067 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 12 (G12S)
Ref Sequence ENSEMBL: ENSMUSP00000147815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033008] [ENSMUST00000135570]
Predicted Effect probably damaging
Transcript: ENSMUST00000033008
AA Change: G37S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033008
Gene: ENSMUSG00000030751
AA Change: G37S

DomainStartEndE-ValueType
Proteasome_A_N 6 28 6.32e-8 SMART
Pfam:Proteasome 29 215 3.2e-54 PFAM
low complexity region 243 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123801
Predicted Effect probably damaging
Transcript: ENSMUST00000135570
AA Change: G12S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210966
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik A T 17: 45,733,744 I17N unknown Het
4932414N04Rik A G 2: 68,741,426 T549A probably benign Het
9330159F19Rik C A 10: 29,225,275 S548Y possibly damaging Het
Aanat A G 11: 116,596,973 Y166C probably damaging Het
Adra2a G T 19: 54,046,239 A9S probably benign Het
Ap4m1 A G 5: 138,172,240 Y17C probably damaging Het
Arhgap33 T G 7: 30,523,835 M891L probably benign Het
Calm5 A G 13: 3,854,372 D22G possibly damaging Het
Ccdc15 C T 9: 37,277,403 R795H probably benign Het
Cngb1 T A 8: 95,263,139 I323F probably damaging Het
Cyp26b1 A G 6: 84,577,189 F74L probably damaging Het
Dpagt1 G A 9: 44,329,142 probably null Het
Ercc8 C T 13: 108,175,589 P196S probably damaging Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Hfm1 G A 5: 106,911,439 S239L probably benign Het
Hgf A G 5: 16,564,801 D91G possibly damaging Het
Lefty2 T A 1: 180,893,263 V27D possibly damaging Het
Lrp2 G A 2: 69,464,624 T3450I possibly damaging Het
Lrrc38 A G 4: 143,350,391 I75V probably damaging Het
Ncor2 C A 5: 125,067,911 E556* probably null Het
Nedd9 A G 13: 41,316,474 L401P probably damaging Het
Nfatc4 T C 14: 55,826,755 L163P probably damaging Het
Nln T C 13: 104,025,061 N667S possibly damaging Het
Olfr1153 A G 2: 87,896,675 T159A possibly damaging Het
Pnpla8 T C 12: 44,283,064 I133T probably benign Het
Psmd3 G A 11: 98,682,881 G51D possibly damaging Het
Ptprb A G 10: 116,380,854 Q1959R probably damaging Het
Rhbdf1 A G 11: 32,210,222 probably null Het
Rnf167 T C 11: 70,649,482 V110A probably damaging Het
Rrp9 C T 9: 106,485,326 S470F probably benign Het
Rtn3 G A 19: 7,458,195 P125L probably benign Het
Scube1 C T 15: 83,676,923 C156Y probably damaging Het
Tgm2 A T 2: 158,131,455 Y245* probably null Het
Timeless T C 10: 128,240,243 I68T probably damaging Het
Ttn A G 2: 76,814,710 S12934P probably damaging Het
Vwa5b2 T A 16: 20,594,678 Y214* probably null Het
Yars2 T A 16: 16,304,620 N7K probably damaging Het
Zfp142 G A 1: 74,578,245 Q150* probably null Het
Zfp995 C T 17: 21,887,358 probably benign Het
Other mutations in Psma1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03001:Psma1 APN 7 114266439 missense probably benign 0.01
tempt UTSW 7 114274448 missense probably damaging 1.00
R0046:Psma1 UTSW 7 114267205 splice site probably benign
R0046:Psma1 UTSW 7 114267205 splice site probably benign
R2062:Psma1 UTSW 7 114269766 missense possibly damaging 0.95
R2217:Psma1 UTSW 7 114264938 missense unknown
R4633:Psma1 UTSW 7 114271134 missense probably damaging 1.00
R6357:Psma1 UTSW 7 114274367 intron probably null
R7137:Psma1 UTSW 7 114274448 missense probably damaging 1.00
R7592:Psma1 UTSW 7 114269726 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCTTCTGGTGAGCGGCAAG -3'
(R):5'- TAGGATCATGGAGTCAGTGGGC -3'

Sequencing Primer
(F):5'- AGCTCTGACTGTGCTCTCTAAATAG -3'
(R):5'- TTGAGCAGCTTAGTAGAACTCC -3'
Posted On2016-10-26