Incidental Mutation 'R5585:Ccdc15'
ID438660
Institutional Source Beutler Lab
Gene Symbol Ccdc15
Ensembl Gene ENSMUSG00000034303
Gene Namecoiled-coil domain containing 15
SynonymsA630039F14Rik
MMRRC Submission 043139-MU
Accession Numbers

Genbank: NM_001081429; MGI: 2444488

Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R5585 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location37275835-37348432 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 37277403 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 795 (R795H)
Ref Sequence ENSEMBL: ENSMUSP00000150207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037275] [ENSMUST00000213633]
Predicted Effect probably benign
Transcript: ENSMUST00000037275
AA Change: R808H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000036784
Gene: ENSMUSG00000034303
AA Change: R808H

DomainStartEndE-ValueType
low complexity region 80 92 N/A INTRINSIC
low complexity region 95 109 N/A INTRINSIC
coiled coil region 173 202 N/A INTRINSIC
coiled coil region 652 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213633
AA Change: R795H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215832
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik A T 17: 45,733,744 I17N unknown Het
4932414N04Rik A G 2: 68,741,426 T549A probably benign Het
9330159F19Rik C A 10: 29,225,275 S548Y possibly damaging Het
Aanat A G 11: 116,596,973 Y166C probably damaging Het
Adra2a G T 19: 54,046,239 A9S probably benign Het
Ap4m1 A G 5: 138,172,240 Y17C probably damaging Het
Arhgap33 T G 7: 30,523,835 M891L probably benign Het
Calm5 A G 13: 3,854,372 D22G possibly damaging Het
Cngb1 T A 8: 95,263,139 I323F probably damaging Het
Cyp26b1 A G 6: 84,577,189 F74L probably damaging Het
Dpagt1 G A 9: 44,329,142 probably null Het
Ercc8 C T 13: 108,175,589 P196S probably damaging Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Hfm1 G A 5: 106,911,439 S239L probably benign Het
Hgf A G 5: 16,564,801 D91G possibly damaging Het
Lefty2 T A 1: 180,893,263 V27D possibly damaging Het
Lrp2 G A 2: 69,464,624 T3450I possibly damaging Het
Lrrc38 A G 4: 143,350,391 I75V probably damaging Het
Ncor2 C A 5: 125,067,911 E556* probably null Het
Nedd9 A G 13: 41,316,474 L401P probably damaging Het
Nfatc4 T C 14: 55,826,755 L163P probably damaging Het
Nln T C 13: 104,025,061 N667S possibly damaging Het
Olfr1153 A G 2: 87,896,675 T159A possibly damaging Het
Pnpla8 T C 12: 44,283,064 I133T probably benign Het
Psma1 C T 7: 114,274,067 G12S probably damaging Het
Psmd3 G A 11: 98,682,881 G51D possibly damaging Het
Ptprb A G 10: 116,380,854 Q1959R probably damaging Het
Rhbdf1 A G 11: 32,210,222 probably null Het
Rnf167 T C 11: 70,649,482 V110A probably damaging Het
Rrp9 C T 9: 106,485,326 S470F probably benign Het
Rtn3 G A 19: 7,458,195 P125L probably benign Het
Scube1 C T 15: 83,676,923 C156Y probably damaging Het
Tgm2 A T 2: 158,131,455 Y245* probably null Het
Timeless T C 10: 128,240,243 I68T probably damaging Het
Ttn A G 2: 76,814,710 S12934P probably damaging Het
Vwa5b2 T A 16: 20,594,678 Y214* probably null Het
Yars2 T A 16: 16,304,620 N7K probably damaging Het
Zfp142 G A 1: 74,578,245 Q150* probably null Het
Zfp995 C T 17: 21,887,358 probably benign Het
Other mutations in Ccdc15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Ccdc15 APN 9 37320473 missense probably damaging 1.00
IGL00823:Ccdc15 APN 9 37320413 missense probably benign 0.01
IGL00979:Ccdc15 APN 9 37316490 missense probably benign 0.44
IGL01380:Ccdc15 APN 9 37276557 utr 3 prime probably benign
IGL01832:Ccdc15 APN 9 37311344 missense probably damaging 0.97
IGL01845:Ccdc15 APN 9 37315236 nonsense probably null
IGL02375:Ccdc15 APN 9 37304332 missense probably damaging 0.99
F6893:Ccdc15 UTSW 9 37315640 missense probably damaging 0.97
FR4304:Ccdc15 UTSW 9 37315157 frame shift probably null
FR4449:Ccdc15 UTSW 9 37315158 frame shift probably null
R1743:Ccdc15 UTSW 9 37277477 nonsense probably null
R1848:Ccdc15 UTSW 9 37342570 missense probably benign 0.00
R1968:Ccdc15 UTSW 9 37347795 missense probably benign 0.05
R2006:Ccdc15 UTSW 9 37315472 missense possibly damaging 0.91
R2372:Ccdc15 UTSW 9 37315505 missense possibly damaging 0.64
R2932:Ccdc15 UTSW 9 37315658 missense probably benign 0.00
R3962:Ccdc15 UTSW 9 37320486 missense probably damaging 1.00
R5919:Ccdc15 UTSW 9 37320396 critical splice donor site probably null
R6000:Ccdc15 UTSW 9 37315764 missense probably benign 0.00
R6198:Ccdc15 UTSW 9 37314285 critical splice donor site probably null
R6476:Ccdc15 UTSW 9 37342419 missense probably benign 0.04
R7098:Ccdc15 UTSW 9 37343960 missense probably damaging 1.00
R7485:Ccdc15 UTSW 9 37315278 missense probably benign
R7548:Ccdc15 UTSW 9 37277427 missense probably benign 0.45
R7627:Ccdc15 UTSW 9 37342402 missense unknown
R7807:Ccdc15 UTSW 9 37315382 missense probably benign 0.07
R8157:Ccdc15 UTSW 9 37315457 missense probably benign
R8230:Ccdc15 UTSW 9 37315259 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTTGGTCCCAAAGTAGATAGAC -3'
(R):5'- AGCTGGAATGAATGCCCATAGC -3'

Sequencing Primer
(F):5'- ATAGACAGTTACGTGGACTTGC -3'
(R):5'- AAGTAGGAGAGCCACCTA -3'
Posted On2016-10-26