Incidental Mutation 'R0071:Ttc41'
ID 43867
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Name tetratricopeptide repeat domain 41
Synonyms Gnn, BC030307
MMRRC Submission 038362-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock # R0071 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 86705811-86776844 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86736846 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 694 (N694S)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075632]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000070435
SMART Domains Protein: ENSMUSP00000136633
Gene: ENSMUSG00000056366

DomainStartEndE-ValueType
Pfam:Lipocalin_7 3 133 6.5e-13 PFAM
Pfam:Lipocalin 6 132 2.9e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075632
AA Change: N694S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: N694S

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219476
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.2%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik A G 16: 14,088,954 D11G probably damaging Het
4930474N05Rik A G 14: 36,090,789 probably benign Het
Acot12 T C 13: 91,781,174 probably benign Het
Acrbp T C 6: 125,050,952 probably benign Het
AI481877 A G 4: 59,059,643 Y1006H possibly damaging Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Aox3 T A 1: 58,171,891 C931* probably null Het
Apob T A 12: 8,002,111 V1184E probably damaging Het
Arhgap44 A T 11: 65,011,895 L582Q possibly damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Bccip A G 7: 133,714,231 D72G probably damaging Het
Bckdha A T 7: 25,630,443 probably null Het
Cald1 C T 6: 34,758,134 probably benign Het
Cdk11b T C 4: 155,649,423 probably benign Het
Cebpe G T 14: 54,710,604 R261S probably damaging Het
Cep95 C T 11: 106,790,728 probably benign Het
Chil1 T C 1: 134,185,279 Y150H probably benign Het
Chrnd T C 1: 87,192,837 probably benign Het
Clec4g T A 8: 3,717,489 probably benign Het
Cog2 T C 8: 124,548,668 probably benign Het
Coro7 A T 16: 4,670,527 L93Q probably damaging Het
Csmd3 T C 15: 47,596,821 T3525A probably benign Het
Ctsc G A 7: 88,308,149 probably benign Het
Dnajc16 T C 4: 141,768,007 T467A probably benign Het
Dnmt1 G A 9: 20,908,620 T1409I probably damaging Het
Fam227b T A 2: 126,124,074 N144Y probably benign Het
Fam83h A G 15: 76,002,528 S987P probably benign Het
Fhod1 A T 8: 105,337,225 probably null Het
Folr1 A G 7: 101,863,923 probably null Het
Glis3 C T 19: 28,263,855 probably benign Het
Gm10069 T C 6: 128,472,725 noncoding transcript Het
Golgb1 G A 16: 36,915,503 R1704Q probably benign Het
Gpr158 C A 2: 21,810,668 T624K probably benign Het
Helz2 T C 2: 181,236,407 Y866C probably damaging Het
Itpkb T A 1: 180,332,765 V152E probably damaging Het
Kcnma1 C T 14: 23,526,767 R236H probably damaging Het
Klhl32 A G 4: 24,743,907 V88A probably damaging Het
Lct C T 1: 128,292,018 W1631* probably null Het
Lipa T A 19: 34,495,082 K313M probably damaging Het
Ly75 T C 2: 60,321,819 K1130R probably benign Het
Mamdc2 C A 19: 23,303,630 E685* probably null Het
Mdm1 A G 10: 118,146,796 E112G probably damaging Het
Metrnl A T 11: 121,716,000 M212L probably benign Het
Mettl2 A G 11: 105,131,642 probably benign Het
Mxd3 A T 13: 55,329,636 L11Q probably damaging Het
Myo7a A T 7: 98,056,830 Y1836N probably damaging Het
Nsun7 A G 5: 66,264,045 Y118C probably benign Het
Obscn G A 11: 59,064,201 T3962M possibly damaging Het
Olfr195 C A 16: 59,149,215 R122S probably benign Het
Olfr53 A T 7: 140,652,257 I93F probably benign Het
Olfr716 A G 7: 107,147,712 Y132C probably damaging Het
Osbpl11 T C 16: 33,214,338 probably benign Het
Pcdhb22 A T 18: 37,520,078 D276V probably damaging Het
Pik3cb A T 9: 99,044,865 D886E probably benign Het
Pkhd1 T A 1: 20,201,344 Y2995F probably benign Het
Raver2 C T 4: 101,120,445 probably benign Het
Rhbdf1 A G 11: 32,210,498 L684P probably damaging Het
Rufy2 C A 10: 62,989,167 L75M possibly damaging Het
Sec22c A G 9: 121,692,913 F44L probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpina1a T C 12: 103,855,743 K310R probably benign Het
Sobp A G 10: 43,157,997 L111P probably damaging Het
Sparcl1 G T 5: 104,085,841 Y547* probably null Het
Spata31d1b G A 13: 59,715,349 A104T probably benign Het
Spert A G 14: 75,584,181 S44P probably benign Het
Spsb3 A G 17: 24,887,904 D184G probably damaging Het
Sptan1 A T 2: 30,003,342 K1148* probably null Het
Tdrd12 A G 7: 35,529,246 V17A possibly damaging Het
Tlr9 A G 9: 106,223,578 T23A probably benign Het
Tra2b A T 16: 22,254,401 probably benign Het
Tspan15 A G 10: 62,203,070 probably benign Het
Ttn T G 2: 76,767,469 D19700A probably damaging Het
Ube3b G A 5: 114,419,497 G1014D probably damaging Het
Unc5d A G 8: 28,719,826 V422A possibly damaging Het
Vmn2r80 C T 10: 79,171,732 T514I possibly damaging Het
Zfp595 T C 13: 67,316,853 K452E possibly damaging Het
Zfp607a A G 7: 27,878,269 K255E probably damaging Het
Zxdc T G 6: 90,370,416 V253G probably damaging Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86736933 missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86775957 missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86776678 missense probably benign
IGL01707:Ttc41 APN 10 86776767 missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86731026 missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86776624 missense probably benign 0.03
IGL01918:Ttc41 APN 10 86713190 missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86775951 missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86760914 nonsense probably null
IGL02887:Ttc41 APN 10 86733654 missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86736857 missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86758348 missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86724414 critical splice donor site probably null
IGL03242:Ttc41 APN 10 86776819 makesense probably null
IGL03307:Ttc41 APN 10 86744440 missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86776047 missense probably benign 0.10
BB013:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0379:Ttc41 UTSW 10 86712977 missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86763947 missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86759097 missense probably benign 0.00
R1589:Ttc41 UTSW 10 86776390 missense probably benign 0.01
R1599:Ttc41 UTSW 10 86776573 missense probably benign 0.04
R1608:Ttc41 UTSW 10 86775993 missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86776252 missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86776214 missense probably benign
R2398:Ttc41 UTSW 10 86713386 missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86724374 missense probably benign 0.42
R3117:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86729798 missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4841:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4842:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4884:Ttc41 UTSW 10 86731018 missense probably benign 0.00
R4885:Ttc41 UTSW 10 86759102 missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86776192 missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86744544 missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86730942 missense probably benign 0.13
R5268:Ttc41 UTSW 10 86744478 missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86776579 missense probably benign 0.04
R5301:Ttc41 UTSW 10 86719520 missense probably benign 0.00
R5425:Ttc41 UTSW 10 86776630 missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86760920 critical splice donor site probably null
R5635:Ttc41 UTSW 10 86736977 missense probably benign 0.09
R5752:Ttc41 UTSW 10 86758346 missense probably benign 0.33
R5868:Ttc41 UTSW 10 86750264 missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86713224 missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86759088 critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86776663 missense probably benign 0.00
R6260:Ttc41 UTSW 10 86731159 missense probably benign 0.20
R6260:Ttc41 UTSW 10 86733707 missense probably benign 0.32
R6276:Ttc41 UTSW 10 86744449 missense probably benign 0.01
R6458:Ttc41 UTSW 10 86758270 missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86713503 missense probably benign 0.17
R7348:Ttc41 UTSW 10 86750348 nonsense probably null
R7382:Ttc41 UTSW 10 86776510 missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86713432 missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86759224 missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86776631 missense probably benign 0.02
R7926:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R7998:Ttc41 UTSW 10 86736847 missense probably benign 0.01
R8021:Ttc41 UTSW 10 86733714 missense probably benign
R8059:Ttc41 UTSW 10 86712978 missense probably benign 0.01
R8170:Ttc41 UTSW 10 86776166 missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86719630 missense probably benign 0.06
R8375:Ttc41 UTSW 10 86763980 missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86719526 missense probably benign 0.00
R8698:Ttc41 UTSW 10 86712977 missense probably benign 0.00
R8773:Ttc41 UTSW 10 86729815 missense probably benign 0.35
R8902:Ttc41 UTSW 10 86713001 missense probably benign 0.06
R8985:Ttc41 UTSW 10 86731092 missense possibly damaging 0.80
R8988:Ttc41 UTSW 10 86713735 missense possibly damaging 0.88
R9007:Ttc41 UTSW 10 86733761 missense probably damaging 1.00
R9137:Ttc41 UTSW 10 86776622 missense probably benign 0.22
R9236:Ttc41 UTSW 10 86776730 missense probably damaging 1.00
R9248:Ttc41 UTSW 10 86731249 missense probably benign 0.00
R9287:Ttc41 UTSW 10 86763966 missense probably benign 0.43
R9345:Ttc41 UTSW 10 86759225 missense probably damaging 0.99
R9386:Ttc41 UTSW 10 86713026 missense probably damaging 0.99
X0024:Ttc41 UTSW 10 86724250 missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86729797 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCATTTGTGACTGCATGTTTGCAT -3'
(R):5'- GGACTCACCTGGGGTTCGTGAT -3'

Sequencing Primer
(F):5'- atttacctttctctgcctccc -3'
(R):5'- CGTGATGAAGTTACATAGACCTTCC -3'
Posted On 2013-05-29