Mutagenetix > Incidental Mutation

Incidental Mutation 'R0071:Ttc41'

43867

Institutional Source

Beutler Lab

Gene Symbol

Ttc41

Ensembl Gene

ENSMUSG00000044937

Gene Name

tetratricopeptide repeat domain 41

Synonyms

Gnn, BC030307

MMRRC Submission

038362-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R0071 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86705811-86776844 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86736846 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 694 (N694S)

Ref Sequence

ENSEMBL: ENSMUSP00000075059 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075632]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000070435

SMART Domains

Protein: ENSMUSP00000136633
Gene: ENSMUSG00000056366

Domain	Start	End	E-Value	Type
Pfam:Lipocalin_7	3	133	6.5e-13	PFAM
Pfam:Lipocalin	6	132	2.9e-31	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000075632
AA Change: N694S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: N694S

Domain	Start	End	E-Value	Type
low complexity region	216	229	N/A	INTRINSIC
low complexity region	307	315	N/A	INTRINSIC
Pfam:NACHT	337	515	5.4e-10	PFAM
SCOP:d1qqea_	805	1028	2e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000219476

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 92.2%

Validation Efficiency

99% (78/79)

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900011O08Rik	A	G	16: 14,088,954	D11G	probably damaging	Het
4930474N05Rik	A	G	14: 36,090,789		probably benign	Het
Acot12	T	C	13: 91,781,174		probably benign	Het
Acrbp	T	C	6: 125,050,952		probably benign	Het
AI481877	A	G	4: 59,059,643	Y1006H	possibly damaging	Het
Amotl1	G	A	9: 14,548,773	A890V	probably benign	Het
Aox3	T	A	1: 58,171,891	C931*	probably null	Het
Apob	T	A	12: 8,002,111	V1184E	probably damaging	Het
Arhgap44	A	T	11: 65,011,895	L582Q	possibly damaging	Het
Bbx	C	T	16: 50,280,392	E47K	probably benign	Het
Bccip	A	G	7: 133,714,231	D72G	probably damaging	Het
Bckdha	A	T	7: 25,630,443		probably null	Het
Cald1	C	T	6: 34,758,134		probably benign	Het
Cdk11b	T	C	4: 155,649,423		probably benign	Het
Cebpe	G	T	14: 54,710,604	R261S	probably damaging	Het
Cep95	C	T	11: 106,790,728		probably benign	Het
Chil1	T	C	1: 134,185,279	Y150H	probably benign	Het
Chrnd	T	C	1: 87,192,837		probably benign	Het
Clec4g	T	A	8: 3,717,489		probably benign	Het
Cog2	T	C	8: 124,548,668		probably benign	Het
Coro7	A	T	16: 4,670,527	L93Q	probably damaging	Het
Csmd3	T	C	15: 47,596,821	T3525A	probably benign	Het
Ctsc	G	A	7: 88,308,149		probably benign	Het
Dnajc16	T	C	4: 141,768,007	T467A	probably benign	Het
Dnmt1	G	A	9: 20,908,620	T1409I	probably damaging	Het
Fam227b	T	A	2: 126,124,074	N144Y	probably benign	Het
Fam83h	A	G	15: 76,002,528	S987P	probably benign	Het
Fhod1	A	T	8: 105,337,225		probably null	Het
Folr1	A	G	7: 101,863,923		probably null	Het
Glis3	C	T	19: 28,263,855		probably benign	Het
Gm10069	T	C	6: 128,472,725		noncoding transcript	Het
Golgb1	G	A	16: 36,915,503	R1704Q	probably benign	Het
Gpr158	C	A	2: 21,810,668	T624K	probably benign	Het
Helz2	T	C	2: 181,236,407	Y866C	probably damaging	Het
Itpkb	T	A	1: 180,332,765	V152E	probably damaging	Het
Kcnma1	C	T	14: 23,526,767	R236H	probably damaging	Het
Klhl32	A	G	4: 24,743,907	V88A	probably damaging	Het
Lct	C	T	1: 128,292,018	W1631*	probably null	Het
Lipa	T	A	19: 34,495,082	K313M	probably damaging	Het
Ly75	T	C	2: 60,321,819	K1130R	probably benign	Het
Mamdc2	C	A	19: 23,303,630	E685*	probably null	Het
Mdm1	A	G	10: 118,146,796	E112G	probably damaging	Het
Metrnl	A	T	11: 121,716,000	M212L	probably benign	Het
Mettl2	A	G	11: 105,131,642		probably benign	Het
Mxd3	A	T	13: 55,329,636	L11Q	probably damaging	Het
Myo7a	A	T	7: 98,056,830	Y1836N	probably damaging	Het
Nsun7	A	G	5: 66,264,045	Y118C	probably benign	Het
Obscn	G	A	11: 59,064,201	T3962M	possibly damaging	Het
Olfr195	C	A	16: 59,149,215	R122S	probably benign	Het
Olfr53	A	T	7: 140,652,257	I93F	probably benign	Het
Olfr716	A	G	7: 107,147,712	Y132C	probably damaging	Het
Osbpl11	T	C	16: 33,214,338		probably benign	Het
Pcdhb22	A	T	18: 37,520,078	D276V	probably damaging	Het
Pik3cb	A	T	9: 99,044,865	D886E	probably benign	Het
Pkhd1	T	A	1: 20,201,344	Y2995F	probably benign	Het
Raver2	C	T	4: 101,120,445		probably benign	Het
Rhbdf1	A	G	11: 32,210,498	L684P	probably damaging	Het
Rufy2	C	A	10: 62,989,167	L75M	possibly damaging	Het
Sec22c	A	G	9: 121,692,913	F44L	probably damaging	Het
Sephs1	A	G	2: 4,899,560	T250A	probably benign	Het
Serpina1a	T	C	12: 103,855,743	K310R	probably benign	Het
Sobp	A	G	10: 43,157,997	L111P	probably damaging	Het
Sparcl1	G	T	5: 104,085,841	Y547*	probably null	Het
Spata31d1b	G	A	13: 59,715,349	A104T	probably benign	Het
Spert	A	G	14: 75,584,181	S44P	probably benign	Het
Spsb3	A	G	17: 24,887,904	D184G	probably damaging	Het
Sptan1	A	T	2: 30,003,342	K1148*	probably null	Het
Tdrd12	A	G	7: 35,529,246	V17A	possibly damaging	Het
Tlr9	A	G	9: 106,223,578	T23A	probably benign	Het
Tra2b	A	T	16: 22,254,401		probably benign	Het
Tspan15	A	G	10: 62,203,070		probably benign	Het
Ttn	T	G	2: 76,767,469	D19700A	probably damaging	Het
Ube3b	G	A	5: 114,419,497	G1014D	probably damaging	Het
Unc5d	A	G	8: 28,719,826	V422A	possibly damaging	Het
Vmn2r80	C	T	10: 79,171,732	T514I	possibly damaging	Het
Zfp595	T	C	13: 67,316,853	K452E	possibly damaging	Het
Zfp607a	A	G	7: 27,878,269	K255E	probably damaging	Het
Zxdc	T	G	6: 90,370,416	V253G	probably damaging	Het

Other mutations in Ttc41

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00846:Ttc41	APN	10	86736933	missense	possibly damaging	0.71
IGL01373:Ttc41	APN	10	86775957	missense	possibly damaging	0.61
IGL01636:Ttc41	APN	10	86776678	missense	probably benign
IGL01707:Ttc41	APN	10	86776767	missense	probably damaging	1.00
IGL01814:Ttc41	APN	10	86731026	missense	probably damaging	0.98
IGL01845:Ttc41	APN	10	86776624	missense	probably benign	0.03
IGL01918:Ttc41	APN	10	86713190	missense	probably damaging	1.00
IGL02374:Ttc41	APN	10	86775951	missense	probably damaging	1.00
IGL02489:Ttc41	APN	10	86760914	nonsense	probably null
IGL02887:Ttc41	APN	10	86733654	missense	probably damaging	1.00
IGL03061:Ttc41	APN	10	86736857	missense	possibly damaging	0.65
IGL03077:Ttc41	APN	10	86758348	missense	probably damaging	1.00
IGL03210:Ttc41	APN	10	86724414	critical splice donor site	probably null
IGL03242:Ttc41	APN	10	86776819	makesense	probably null
IGL03307:Ttc41	APN	10	86744440	missense	possibly damaging	0.76
BB003:Ttc41	UTSW	10	86776047	missense	probably benign	0.10
BB013:Ttc41	UTSW	10	86776047	missense	probably benign	0.10
R0071:Ttc41	UTSW	10	86736846	missense	probably benign	0.01
R0379:Ttc41	UTSW	10	86712977	missense	possibly damaging	0.65
R0384:Ttc41	UTSW	10	86763947	missense	probably damaging	1.00
R0545:Ttc41	UTSW	10	86759097	missense	probably benign	0.00
R1589:Ttc41	UTSW	10	86776390	missense	probably benign	0.01
R1599:Ttc41	UTSW	10	86776573	missense	probably benign	0.04
R1608:Ttc41	UTSW	10	86775993	missense	probably damaging	1.00
R1670:Ttc41	UTSW	10	86776252	missense	possibly damaging	0.93
R1938:Ttc41	UTSW	10	86776214	missense	probably benign
R2398:Ttc41	UTSW	10	86713386	missense	possibly damaging	0.91
R2401:Ttc41	UTSW	10	86724374	missense	probably benign	0.42
R3117:Ttc41	UTSW	10	86724320	missense	possibly damaging	0.62
R3119:Ttc41	UTSW	10	86724320	missense	possibly damaging	0.62
R4805:Ttc41	UTSW	10	86729798	missense	possibly damaging	0.62
R4840:Ttc41	UTSW	10	86731125	missense	probably benign	0.10
R4841:Ttc41	UTSW	10	86731125	missense	probably benign	0.10
R4842:Ttc41	UTSW	10	86731125	missense	probably benign	0.10
R4884:Ttc41	UTSW	10	86731018	missense	probably benign	0.00
R4885:Ttc41	UTSW	10	86759102	missense	possibly damaging	0.76
R4898:Ttc41	UTSW	10	86776192	missense	possibly damaging	0.80
R5067:Ttc41	UTSW	10	86744544	missense	probably damaging	0.96
R5253:Ttc41	UTSW	10	86730942	missense	probably benign	0.13
R5268:Ttc41	UTSW	10	86744478	missense	possibly damaging	0.76
R5297:Ttc41	UTSW	10	86776579	missense	probably benign	0.04
R5301:Ttc41	UTSW	10	86719520	missense	probably benign	0.00
R5425:Ttc41	UTSW	10	86776630	missense	probably damaging	0.96
R5567:Ttc41	UTSW	10	86760920	critical splice donor site	probably null
R5635:Ttc41	UTSW	10	86736977	missense	probably benign	0.09
R5752:Ttc41	UTSW	10	86758346	missense	probably benign	0.33
R5868:Ttc41	UTSW	10	86750264	missense	possibly damaging	0.70
R5948:Ttc41	UTSW	10	86713224	missense	probably damaging	1.00
R6116:Ttc41	UTSW	10	86759088	critical splice acceptor site	probably null
R6247:Ttc41	UTSW	10	86776663	missense	probably benign	0.00
R6260:Ttc41	UTSW	10	86731159	missense	probably benign	0.20
R6260:Ttc41	UTSW	10	86733707	missense	probably benign	0.32
R6276:Ttc41	UTSW	10	86744449	missense	probably benign	0.01
R6458:Ttc41	UTSW	10	86758270	missense	possibly damaging	0.45
R7170:Ttc41	UTSW	10	86713503	missense	probably benign	0.17
R7348:Ttc41	UTSW	10	86750348	nonsense	probably null
R7382:Ttc41	UTSW	10	86776510	missense	probably damaging	0.97
R7509:Ttc41	UTSW	10	86713432	missense	probably damaging	1.00
R7689:Ttc41	UTSW	10	86759224	missense	probably damaging	1.00
R7807:Ttc41	UTSW	10	86776631	missense	probably benign	0.02
R7926:Ttc41	UTSW	10	86776047	missense	probably benign	0.10
R7998:Ttc41	UTSW	10	86736847	missense	probably benign	0.01
R8021:Ttc41	UTSW	10	86733714	missense	probably benign
R8059:Ttc41	UTSW	10	86712978	missense	probably benign	0.01
R8170:Ttc41	UTSW	10	86776166	missense	probably damaging	1.00
R8303:Ttc41	UTSW	10	86719630	missense	probably benign	0.06
R8375:Ttc41	UTSW	10	86763980	missense	probably damaging	0.97
R8383:Ttc41	UTSW	10	86719526	missense	probably benign	0.00
R8698:Ttc41	UTSW	10	86712977	missense	probably benign	0.00
R8773:Ttc41	UTSW	10	86729815	missense	probably benign	0.35
R8902:Ttc41	UTSW	10	86713001	missense	probably benign	0.06
R8985:Ttc41	UTSW	10	86731092	missense	possibly damaging	0.80
R8988:Ttc41	UTSW	10	86713735	missense	possibly damaging	0.88
R9007:Ttc41	UTSW	10	86733761	missense	probably damaging	1.00
R9137:Ttc41	UTSW	10	86776622	missense	probably benign	0.22
R9236:Ttc41	UTSW	10	86776730	missense	probably damaging	1.00
R9248:Ttc41	UTSW	10	86731249	missense	probably benign	0.00
R9287:Ttc41	UTSW	10	86763966	missense	probably benign	0.43
R9345:Ttc41	UTSW	10	86759225	missense	probably damaging	0.99
R9386:Ttc41	UTSW	10	86713026	missense	probably damaging	0.99
R9500:Ttc41	UTSW	10	86729862	missense	probably benign	0.03
R9570:Ttc41	UTSW	10	86713734	missense	possibly damaging	0.88
R9593:Ttc41	UTSW	10	86713185	missense	probably benign	0.24
X0024:Ttc41	UTSW	10	86724250	missense	probably damaging	1.00
X0064:Ttc41	UTSW	10	86729797	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGCATTTGTGACTGCATGTTTGCAT -3'
(R):5'- GGACTCACCTGGGGTTCGTGAT -3'

Sequencing Primer
(F):5'- atttacctttctctgcctccc -3'
(R):5'- CGTGATGAAGTTACATAGACCTTCC -3'

Posted On

2013-05-29