Incidental Mutation 'R5585:Ercc8'
ID438675
Institutional Source Beutler Lab
Gene Symbol Ercc8
Ensembl Gene ENSMUSG00000021694
Gene Nameexcision repaiross-complementing rodent repair deficiency, complementation group 8
Synonyms2810431L23Rik, 4631412O06Rik, B130065P18Rik, 2410022P04Rik, Csa, Ckn1
MMRRC Submission 043139-MU
Accession Numbers

Genbank: NM_028042

Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R5585 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location108158731-108195364 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108175589 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 196 (P196S)
Ref Sequence ENSEMBL: ENSMUSP00000059211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054835] [ENSMUST00000120672] [ENSMUST00000123182] [ENSMUST00000123657] [ENSMUST00000129117] [ENSMUST00000133957] [ENSMUST00000142931] [ENSMUST00000152634]
Predicted Effect probably damaging
Transcript: ENSMUST00000054835
AA Change: P196S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059211
Gene: ENSMUSG00000021694
AA Change: P196S

DomainStartEndE-ValueType
WD40 35 72 3.21e-1 SMART
WD40 81 128 9.75e-3 SMART
WD40 175 215 2.71e-10 SMART
WD40 234 273 9.24e-4 SMART
WD40 323 362 7.5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120672
SMART Domains Protein: ENSMUSP00000112746
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
WD40 35 72 3.21e-1 SMART
WD40 81 128 9.75e-3 SMART
Blast:WD40 137 172 6e-6 BLAST
low complexity region 186 198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123138
SMART Domains Protein: ENSMUSP00000119212
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
PDB:4A11|B 2 54 4e-29 PDB
Blast:WD40 28 54 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123182
SMART Domains Protein: ENSMUSP00000121777
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
PDB:4A11|B 1 57 9e-32 PDB
Blast:WD40 31 57 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123657
SMART Domains Protein: ENSMUSP00000117492
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
PDB:4A11|B 1 57 9e-32 PDB
Blast:WD40 31 57 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000129117
SMART Domains Protein: ENSMUSP00000116507
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
PDB:4A11|B 1 57 9e-32 PDB
Blast:WD40 31 57 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000133957
SMART Domains Protein: ENSMUSP00000116226
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
PDB:4A11|B 1 54 3e-30 PDB
Blast:WD40 28 54 2e-11 BLAST
Predicted Effect silent
Transcript: ENSMUST00000142931
SMART Domains Protein: ENSMUSP00000118154
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
WD40 35 72 3.21e-1 SMART
WD40 81 128 9.75e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152634
SMART Domains Protein: ENSMUSP00000122802
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
PDB:4A11|B 1 57 9e-32 PDB
Blast:WD40 31 57 2e-11 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat protein, which interacts with Cockayne syndrome type B (CSB) protein and with p44 protein, a subunit of the RNA polymerase II transcription factor IIH. Mutations in this gene have been identified in patients with hereditary disease Cockayne syndrome (CS). CS cells are abnormally sensitive to ultraviolet radiation and are defective in the repair of transcriptionally active genes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous mutation of this gene results in skin photosensitivity, increased incidence of skin tumors after UV exposure, and progressive photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik A T 17: 45,733,744 I17N unknown Het
4932414N04Rik A G 2: 68,741,426 T549A probably benign Het
9330159F19Rik C A 10: 29,225,275 S548Y possibly damaging Het
Aanat A G 11: 116,596,973 Y166C probably damaging Het
Adra2a G T 19: 54,046,239 A9S probably benign Het
Ap4m1 A G 5: 138,172,240 Y17C probably damaging Het
Arhgap33 T G 7: 30,523,835 M891L probably benign Het
Calm5 A G 13: 3,854,372 D22G possibly damaging Het
Ccdc15 C T 9: 37,277,403 R795H probably benign Het
Cngb1 T A 8: 95,263,139 I323F probably damaging Het
Cyp26b1 A G 6: 84,577,189 F74L probably damaging Het
Dpagt1 G A 9: 44,329,142 probably null Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Hfm1 G A 5: 106,911,439 S239L probably benign Het
Hgf A G 5: 16,564,801 D91G possibly damaging Het
Lefty2 T A 1: 180,893,263 V27D possibly damaging Het
Lrp2 G A 2: 69,464,624 T3450I possibly damaging Het
Lrrc38 A G 4: 143,350,391 I75V probably damaging Het
Ncor2 C A 5: 125,067,911 E556* probably null Het
Nedd9 A G 13: 41,316,474 L401P probably damaging Het
Nfatc4 T C 14: 55,826,755 L163P probably damaging Het
Nln T C 13: 104,025,061 N667S possibly damaging Het
Olfr1153 A G 2: 87,896,675 T159A possibly damaging Het
Pnpla8 T C 12: 44,283,064 I133T probably benign Het
Psma1 C T 7: 114,274,067 G12S probably damaging Het
Psmd3 G A 11: 98,682,881 G51D possibly damaging Het
Ptprb A G 10: 116,380,854 Q1959R probably damaging Het
Rhbdf1 A G 11: 32,210,222 probably null Het
Rnf167 T C 11: 70,649,482 V110A probably damaging Het
Rrp9 C T 9: 106,485,326 S470F probably benign Het
Rtn3 G A 19: 7,458,195 P125L probably benign Het
Scube1 C T 15: 83,676,923 C156Y probably damaging Het
Tgm2 A T 2: 158,131,455 Y245* probably null Het
Timeless T C 10: 128,240,243 I68T probably damaging Het
Ttn A G 2: 76,814,710 S12934P probably damaging Het
Vwa5b2 T A 16: 20,594,678 Y214* probably null Het
Yars2 T A 16: 16,304,620 N7K probably damaging Het
Zfp142 G A 1: 74,578,245 Q150* probably null Het
Zfp995 C T 17: 21,887,358 probably benign Het
Other mutations in Ercc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01832:Ercc8 APN 13 108169459 missense probably damaging 1.00
IGL02074:Ercc8 APN 13 108158784 unclassified probably benign
B5639:Ercc8 UTSW 13 108160723 missense probably damaging 0.96
R0620:Ercc8 UTSW 13 108174061 critical splice donor site probably null
R1909:Ercc8 UTSW 13 108175566 nonsense probably null
R2509:Ercc8 UTSW 13 108183717 splice site probably benign
R2967:Ercc8 UTSW 13 108160714 missense probably damaging 1.00
R3857:Ercc8 UTSW 13 108194114 missense possibly damaging 0.82
R4941:Ercc8 UTSW 13 108160767 unclassified probably benign
R6023:Ercc8 UTSW 13 108178577 missense probably damaging 1.00
R6363:Ercc8 UTSW 13 108183870 missense probably damaging 1.00
R6483:Ercc8 UTSW 13 108183810 missense probably damaging 0.99
R6825:Ercc8 UTSW 13 108158809 missense probably damaging 0.97
R7151:Ercc8 UTSW 13 108187282 critical splice donor site probably null
R7166:Ercc8 UTSW 13 108169433 missense possibly damaging 0.94
R7710:Ercc8 UTSW 13 108183863 missense probably benign
R8395:Ercc8 UTSW 13 108187254 nonsense probably null
R8678:Ercc8 UTSW 13 108169493 critical splice donor site probably null
R8744:Ercc8 UTSW 13 108183773 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGAAGACACTGCAAGTTTAAGAC -3'
(R):5'- ACACTCATACATGTGCACCTG -3'

Sequencing Primer
(F):5'- GACACTGCAAGTTTAAGACATGATC -3'
(R):5'- GATGCAAAGGATATTTTCTTGACTG -3'
Posted On2016-10-26