Incidental Mutation 'R5585:Yars2'
ID438678
Institutional Source Beutler Lab
Gene Symbol Yars2
Ensembl Gene ENSMUSG00000022792
Gene Nametyrosyl-tRNA synthetase 2 (mitochondrial)
Synonyms2210023C10Rik
MMRRC Submission 043139-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R5585 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location16302965-16309640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16304620 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 7 (N7K)
Ref Sequence ENSEMBL: ENSMUSP00000125496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059955] [ENSMUST00000159683] [ENSMUST00000159962] [ENSMUST00000162734]
Predicted Effect probably damaging
Transcript: ENSMUST00000059955
AA Change: N283K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055277
Gene: ENSMUSG00000022792
AA Change: N283K

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 64 370 5.9e-74 PFAM
Blast:S4 403 466 1e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159583
Predicted Effect probably damaging
Transcript: ENSMUST00000159683
AA Change: N283K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124606
Gene: ENSMUSG00000022792
AA Change: N283K

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 64 332 1.4e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159962
AA Change: N283K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125252
Gene: ENSMUSG00000022792
AA Change: N283K

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 64 332 1.4e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161191
Predicted Effect probably damaging
Transcript: ENSMUST00000162734
AA Change: N7K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125496
Gene: ENSMUSG00000022792
AA Change: N7K

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 1 102 7.2e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein that catalyzes the attachment of tyrosine to tRNA(Tyr). Mutations in this gene are associated with myopathy with lactic acidosis and sideroblastic anemia type 2 (MLASA2). [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik A T 17: 45,733,744 I17N unknown Het
4932414N04Rik A G 2: 68,741,426 T549A probably benign Het
9330159F19Rik C A 10: 29,225,275 S548Y possibly damaging Het
Aanat A G 11: 116,596,973 Y166C probably damaging Het
Adra2a G T 19: 54,046,239 A9S probably benign Het
Ap4m1 A G 5: 138,172,240 Y17C probably damaging Het
Arhgap33 T G 7: 30,523,835 M891L probably benign Het
Calm5 A G 13: 3,854,372 D22G possibly damaging Het
Ccdc15 C T 9: 37,277,403 R795H probably benign Het
Cngb1 T A 8: 95,263,139 I323F probably damaging Het
Cyp26b1 A G 6: 84,577,189 F74L probably damaging Het
Dpagt1 G A 9: 44,329,142 probably null Het
Ercc8 C T 13: 108,175,589 P196S probably damaging Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Hfm1 G A 5: 106,911,439 S239L probably benign Het
Hgf A G 5: 16,564,801 D91G possibly damaging Het
Lefty2 T A 1: 180,893,263 V27D possibly damaging Het
Lrp2 G A 2: 69,464,624 T3450I possibly damaging Het
Lrrc38 A G 4: 143,350,391 I75V probably damaging Het
Ncor2 C A 5: 125,067,911 E556* probably null Het
Nedd9 A G 13: 41,316,474 L401P probably damaging Het
Nfatc4 T C 14: 55,826,755 L163P probably damaging Het
Nln T C 13: 104,025,061 N667S possibly damaging Het
Olfr1153 A G 2: 87,896,675 T159A possibly damaging Het
Pnpla8 T C 12: 44,283,064 I133T probably benign Het
Psma1 C T 7: 114,274,067 G12S probably damaging Het
Psmd3 G A 11: 98,682,881 G51D possibly damaging Het
Ptprb A G 10: 116,380,854 Q1959R probably damaging Het
Rhbdf1 A G 11: 32,210,222 probably null Het
Rnf167 T C 11: 70,649,482 V110A probably damaging Het
Rrp9 C T 9: 106,485,326 S470F probably benign Het
Rtn3 G A 19: 7,458,195 P125L probably benign Het
Scube1 C T 15: 83,676,923 C156Y probably damaging Het
Tgm2 A T 2: 158,131,455 Y245* probably null Het
Timeless T C 10: 128,240,243 I68T probably damaging Het
Ttn A G 2: 76,814,710 S12934P probably damaging Het
Vwa5b2 T A 16: 20,594,678 Y214* probably null Het
Zfp142 G A 1: 74,578,245 Q150* probably null Het
Zfp995 C T 17: 21,887,358 probably benign Het
Other mutations in Yars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Yars2 APN 16 16303321 missense probably damaging 0.99
IGL01061:Yars2 APN 16 16306542 nonsense probably null
IGL01062:Yars2 APN 16 16306542 nonsense probably null
IGL01063:Yars2 APN 16 16306542 nonsense probably null
IGL01066:Yars2 APN 16 16306542 nonsense probably null
IGL01069:Yars2 APN 16 16306542 nonsense probably null
IGL01070:Yars2 APN 16 16306542 nonsense probably null
IGL02928:Yars2 APN 16 16303546 missense probably damaging 1.00
R4718:Yars2 UTSW 16 16309340 missense probably benign 0.00
R5012:Yars2 UTSW 16 16303584 missense probably damaging 0.98
R5498:Yars2 UTSW 16 16306523 missense possibly damaging 0.62
R5935:Yars2 UTSW 16 16309471 missense probably benign 0.02
R6302:Yars2 UTSW 16 16304574 missense probably damaging 1.00
R6344:Yars2 UTSW 16 16303035 missense probably benign
R7218:Yars2 UTSW 16 16303318 missense probably damaging 1.00
R7235:Yars2 UTSW 16 16304692 missense probably benign
R7838:Yars2 UTSW 16 16304521 splice site probably null
R8311:Yars2 UTSW 16 16307283 missense probably benign 0.00
X0062:Yars2 UTSW 16 16303018 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ATGGTTCTTGAGGACCTGAGTC -3'
(R):5'- TCTTGAGCAACTTAGAACATCGC -3'

Sequencing Primer
(F):5'- CCAGACTGAGAAAGGGTTTTAAAAAC -3'
(R):5'- CCTGGGATGTAGCTCAATAGTTAAGC -3'
Posted On2016-10-26