Incidental Mutation 'R5586:Uba6'
ID 438707
Institutional Source Beutler Lab
Gene Symbol Uba6
Ensembl Gene ENSMUSG00000035898
Gene Name ubiquitin-like modifier activating enzyme 6
Synonyms Ube1l2, 5730469D23Rik
MMRRC Submission 043140-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5586 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 86258579-86320602 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86282906 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 559 (D559G)
Ref Sequence ENSEMBL: ENSMUSP00000109000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039373] [ENSMUST00000113373]
AlphaFold Q8C7R4
Predicted Effect probably damaging
Transcript: ENSMUST00000039373
AA Change: D590G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035328
Gene: ENSMUSG00000035898
AA Change: D590G

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
Pfam:ThiF 44 431 8.9e-29 PFAM
Pfam:E1_FCCH 224 293 1.7e-28 PFAM
Pfam:E1_4HB 294 362 9.8e-21 PFAM
internal_repeat_1 443 588 1.25e-6 PROSPERO
Pfam:UBA_e1_thiolCys 631 884 3.7e-80 PFAM
UBA_e1_C 921 1043 1.04e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113373
AA Change: D559G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109000
Gene: ENSMUSG00000035898
AA Change: D559G

DomainStartEndE-ValueType
Pfam:ThiF 29 167 1.8e-16 PFAM
Pfam:ThiF 428 573 8.5e-34 PFAM
Pfam:UBA_e1_thiolCys 575 619 2.3e-22 PFAM
Pfam:UBACT 817 885 2.9e-28 PFAM
UBA_e1_C 890 1012 1.04e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147734
Meta Mutation Damage Score 0.9465 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of proteins with ubiquitin (UBB; MIM 191339) or ubiquitin-like proteins controls many signaling networks and requires a ubiquitin-activating enzyme (E1), a ubiquitin conjugating enzyme (E2), and a ubiquitin protein ligase (E3). UBE1L2 is an E1 enzyme that initiates the activation and conjugation of ubiquitin-like proteins (Jin et al., 2007 [PubMed 17597759]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice homozygous for a conditional allele activated in neurons exhibit decreased weight, postnatal and premature lethality and altered social behavior and neuronal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,277,153 (GRCm39) noncoding transcript Het
Aaas A T 15: 102,255,111 (GRCm39) probably null Het
Abcc3 G A 11: 94,255,247 (GRCm39) R600W probably damaging Het
Abhd13 A T 8: 10,038,318 (GRCm39) Q305L probably benign Het
Adcy5 A T 16: 34,977,486 (GRCm39) I340F probably damaging Het
Adgrl3 T A 5: 81,871,994 (GRCm39) I964N probably damaging Het
Anks1b T A 10: 89,912,926 (GRCm39) H316Q probably damaging Het
Ap3d1 A T 10: 80,554,964 (GRCm39) F454I possibly damaging Het
Apol7c T C 15: 77,410,599 (GRCm39) R116G possibly damaging Het
Arhgap5 A G 12: 52,566,695 (GRCm39) E1222G possibly damaging Het
AW551984 A G 9: 39,502,559 (GRCm39) V673A probably benign Het
Baiap2l1 A G 5: 144,218,949 (GRCm39) S220P probably damaging Het
Bcl6 A G 16: 23,791,926 (GRCm39) F143L probably benign Het
Calb1 A T 4: 15,900,811 (GRCm39) T165S probably benign Het
Ccdc66 C A 14: 27,228,668 (GRCm39) G6C probably damaging Het
Ccdc88a A G 11: 29,453,484 (GRCm39) I344V probably benign Het
Cdh19 T A 1: 110,857,587 (GRCm39) D249V probably damaging Het
Ces1c T A 8: 93,854,227 (GRCm39) T103S probably benign Het
Cfap54 T A 10: 92,808,473 (GRCm39) K1401* probably null Het
Copa T A 1: 171,932,789 (GRCm39) N371K probably damaging Het
Cyp2b10 A T 7: 25,616,437 (GRCm39) Y348F probably damaging Het
Dennd5a T C 7: 109,504,928 (GRCm39) R861G possibly damaging Het
Dhx8 T C 11: 101,623,862 (GRCm39) probably benign Het
Dido1 C T 2: 180,301,445 (GRCm39) W2153* probably null Het
Dlgap1 T A 17: 71,125,156 (GRCm39) V969D probably damaging Het
Dvl3 A G 16: 20,336,039 (GRCm39) D32G probably damaging Het
Epdr1 T C 13: 19,778,718 (GRCm39) D24G probably benign Het
Etnk2 T A 1: 133,307,043 (GRCm39) probably null Het
Fhad1 C T 4: 141,632,442 (GRCm39) M1232I probably benign Het
Gcnt2 A C 13: 41,014,429 (GRCm39) E200A probably damaging Het
Gm5174 A G 10: 86,492,409 (GRCm39) noncoding transcript Het
Gm6408 T A 5: 146,421,267 (GRCm39) F299I possibly damaging Het
Gpr85 G T 6: 13,836,000 (GRCm39) Y301* probably null Het
Gucy2e G T 11: 69,117,082 (GRCm39) P780T probably damaging Het
Icam5 A T 9: 20,946,116 (GRCm39) N316I probably damaging Het
Ifit1bl1 C T 19: 34,571,677 (GRCm39) R260Q probably damaging Het
Il1r1 A C 1: 40,264,411 (GRCm39) probably benign Het
Kif3c A T 12: 3,439,656 (GRCm39) I86F probably benign Het
Klhdc2 A G 12: 69,354,467 (GRCm39) probably null Het
Mast2 A G 4: 116,292,760 (GRCm39) L9P probably damaging Het
Mcoln1 G T 8: 3,560,389 (GRCm39) C316F probably damaging Het
Mon1a A T 9: 107,775,894 (GRCm39) D4V probably damaging Het
Ms4a18 T A 19: 10,991,038 (GRCm39) M19L probably benign Het
Nbea T C 3: 55,539,392 (GRCm39) K2790E probably benign Het
Niban1 C T 1: 151,593,307 (GRCm39) T664I probably benign Het
Noc3l C T 19: 38,803,139 (GRCm39) E167K possibly damaging Het
Nol10 G A 12: 17,466,829 (GRCm39) E570K possibly damaging Het
Nr2e3 T C 9: 59,856,484 (GRCm39) R69G probably damaging Het
Obscn G A 11: 58,892,294 (GRCm39) R1358* probably null Het
Or14j4 A T 17: 37,921,145 (GRCm39) F166I probably damaging Het
Or2b7 C A 13: 21,739,266 (GRCm39) V309F probably damaging Het
Or52e8b A G 7: 104,673,428 (GRCm39) I253T probably damaging Het
Or5b117 A T 19: 13,431,746 (GRCm39) M45K probably benign Het
Pak2 A T 16: 31,860,337 (GRCm39) D175E probably benign Het
Pccb C T 9: 100,867,856 (GRCm39) V357I possibly damaging Het
Pcdhb4 C T 18: 37,442,034 (GRCm39) P448L probably damaging Het
Pcdhb9 A G 18: 37,534,167 (GRCm39) M54V probably benign Het
Ppp3cb A G 14: 20,570,758 (GRCm39) probably benign Het
Ppp4r1 A G 17: 66,131,563 (GRCm39) D452G probably benign Het
Pramel18 T A 4: 101,767,317 (GRCm39) F189I probably benign Het
Prmt3 T A 7: 49,476,499 (GRCm39) D369E probably damaging Het
Psmd12 T A 11: 107,377,301 (GRCm39) V120D probably benign Het
Ptprb T C 10: 116,189,732 (GRCm39) L1797P probably damaging Het
Ptprm A G 17: 67,227,191 (GRCm39) S653P probably damaging Het
Pxdn T A 12: 30,053,141 (GRCm39) V926D probably damaging Het
Retreg3 T G 11: 100,997,165 (GRCm39) Q105P probably damaging Het
Sacs A T 14: 61,443,890 (GRCm39) R1979* probably null Het
Scn2a T A 2: 65,537,639 (GRCm39) L696* probably null Het
Sema3c A T 5: 17,916,422 (GRCm39) N465Y probably damaging Het
Slc25a32 A T 15: 38,963,308 (GRCm39) V171E possibly damaging Het
Slc30a7 C T 3: 115,783,700 (GRCm39) V158I probably benign Het
Slc44a5 G A 3: 153,975,802 (GRCm39) probably benign Het
Slc4a8 A G 15: 100,685,045 (GRCm39) D140G probably damaging Het
Slc7a11 G A 3: 50,397,532 (GRCm39) S60L possibly damaging Het
Spryd3 A T 15: 102,040,372 (GRCm39) H59Q probably benign Het
Sqstm1 T C 11: 50,093,849 (GRCm39) D256G probably damaging Het
Sst A T 16: 23,708,487 (GRCm39) S115T probably damaging Het
Stimate A G 14: 30,592,776 (GRCm39) K166E probably damaging Het
Surf1 T C 2: 26,805,963 (GRCm39) probably benign Het
Synj1 A T 16: 90,806,865 (GRCm39) probably benign Het
Tet1 C A 10: 62,714,073 (GRCm39) C574F probably damaging Het
Thnsl1 T A 2: 21,217,201 (GRCm39) Y318* probably null Het
Tomm70a A G 16: 56,942,493 (GRCm39) E90G probably damaging Het
Treml4 A G 17: 48,571,927 (GRCm39) D110G probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Txnl1 C T 18: 63,797,396 (GRCm39) G283D probably damaging Het
Usp4 T C 9: 108,233,661 (GRCm39) V94A possibly damaging Het
Vmn2r25 A C 6: 123,802,255 (GRCm39) C549W probably damaging Het
Vmn2r59 G T 7: 41,695,105 (GRCm39) Q436K probably benign Het
Wdr70 A T 15: 7,913,769 (GRCm39) Y627N possibly damaging Het
Xpr1 T C 1: 155,188,609 (GRCm39) I344V probably benign Het
Zfp423 T A 8: 88,585,968 (GRCm39) Q61L possibly damaging Het
Other mutations in Uba6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Uba6 APN 5 86,267,266 (GRCm39) missense possibly damaging 0.51
IGL01294:Uba6 APN 5 86,297,907 (GRCm39) missense possibly damaging 0.67
IGL01625:Uba6 APN 5 86,268,388 (GRCm39) nonsense probably null
IGL01807:Uba6 APN 5 86,270,270 (GRCm39) missense probably damaging 1.00
IGL01919:Uba6 APN 5 86,267,245 (GRCm39) missense probably benign 0.01
IGL02131:Uba6 APN 5 86,297,936 (GRCm39) missense probably benign 0.18
IGL03107:Uba6 APN 5 86,275,633 (GRCm39) splice site probably benign
R0314:Uba6 UTSW 5 86,265,946 (GRCm39) missense probably damaging 0.99
R0350:Uba6 UTSW 5 86,292,237 (GRCm39) missense possibly damaging 0.48
R0511:Uba6 UTSW 5 86,260,609 (GRCm39) missense probably damaging 1.00
R0964:Uba6 UTSW 5 86,267,260 (GRCm39) missense possibly damaging 0.47
R1086:Uba6 UTSW 5 86,275,578 (GRCm39) missense probably benign 0.00
R1440:Uba6 UTSW 5 86,288,282 (GRCm39) missense probably damaging 1.00
R1564:Uba6 UTSW 5 86,302,266 (GRCm39) missense probably benign
R2377:Uba6 UTSW 5 86,272,229 (GRCm39) missense possibly damaging 0.90
R2420:Uba6 UTSW 5 86,280,475 (GRCm39) critical splice donor site probably null
R2421:Uba6 UTSW 5 86,280,475 (GRCm39) critical splice donor site probably null
R2422:Uba6 UTSW 5 86,280,475 (GRCm39) critical splice donor site probably null
R2924:Uba6 UTSW 5 86,307,130 (GRCm39) missense probably damaging 1.00
R3723:Uba6 UTSW 5 86,282,906 (GRCm39) missense probably damaging 1.00
R3724:Uba6 UTSW 5 86,282,906 (GRCm39) missense probably damaging 1.00
R4429:Uba6 UTSW 5 86,268,406 (GRCm39) missense probably damaging 0.99
R4590:Uba6 UTSW 5 86,260,603 (GRCm39) missense probably damaging 1.00
R4831:Uba6 UTSW 5 86,279,197 (GRCm39) missense probably benign
R4908:Uba6 UTSW 5 86,288,293 (GRCm39) splice site silent
R5193:Uba6 UTSW 5 86,272,281 (GRCm39) missense probably benign 0.12
R5505:Uba6 UTSW 5 86,268,405 (GRCm39) missense probably benign 0.09
R5560:Uba6 UTSW 5 86,279,119 (GRCm39) missense probably damaging 1.00
R5589:Uba6 UTSW 5 86,270,288 (GRCm39) missense probably damaging 0.99
R5787:Uba6 UTSW 5 86,260,511 (GRCm39) makesense probably null
R6255:Uba6 UTSW 5 86,312,624 (GRCm39) missense probably benign 0.25
R6512:Uba6 UTSW 5 86,272,262 (GRCm39) missense probably benign
R6772:Uba6 UTSW 5 86,294,932 (GRCm39) critical splice donor site probably benign
R7536:Uba6 UTSW 5 86,272,191 (GRCm39) missense probably benign 0.05
R7571:Uba6 UTSW 5 86,294,970 (GRCm39) missense probably benign 0.02
R7609:Uba6 UTSW 5 86,294,934 (GRCm39) missense probably benign 0.17
R7768:Uba6 UTSW 5 86,300,779 (GRCm39) missense probably benign 0.01
R7839:Uba6 UTSW 5 86,270,271 (GRCm39) splice site probably null
R7866:Uba6 UTSW 5 86,320,560 (GRCm39) missense probably damaging 0.99
R7894:Uba6 UTSW 5 86,265,924 (GRCm39) nonsense probably null
R8063:Uba6 UTSW 5 86,300,544 (GRCm39) missense probably benign 0.29
R8276:Uba6 UTSW 5 86,290,509 (GRCm39) intron probably benign
R8382:Uba6 UTSW 5 86,279,196 (GRCm39) missense probably benign 0.01
R8516:Uba6 UTSW 5 86,275,607 (GRCm39) missense possibly damaging 0.78
R8673:Uba6 UTSW 5 86,284,178 (GRCm39) missense probably damaging 1.00
R8778:Uba6 UTSW 5 86,260,556 (GRCm39) missense possibly damaging 0.54
R8817:Uba6 UTSW 5 86,296,772 (GRCm39) missense probably null 0.10
R8822:Uba6 UTSW 5 86,294,932 (GRCm39) critical splice donor site probably benign
R8852:Uba6 UTSW 5 86,289,454 (GRCm39) missense possibly damaging 0.47
R8887:Uba6 UTSW 5 86,307,061 (GRCm39) critical splice donor site probably null
R9108:Uba6 UTSW 5 86,282,934 (GRCm39) missense possibly damaging 0.69
R9245:Uba6 UTSW 5 86,318,418 (GRCm39) missense probably damaging 1.00
R9511:Uba6 UTSW 5 86,288,219 (GRCm39) missense probably damaging 1.00
R9669:Uba6 UTSW 5 86,268,499 (GRCm39) missense probably benign 0.05
R9677:Uba6 UTSW 5 86,265,910 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACATATGGGTCAACCTG -3'
(R):5'- AACTGTTACGTGGGTCATGTTCTATTC -3'

Sequencing Primer
(F):5'- CATATGGGTCAACCTGTCAGAGC -3'
(R):5'- GTGGGTCATGTTCTATTCGCTACAC -3'
Posted On 2016-10-26