Mutagenetix > Incidental Mutation

Incidental Mutation 'R5586:Baiap2l1'

438708

Institutional Source

Beutler Lab

Gene Symbol

Baiap2l1

Ensembl Gene

ENSMUSG00000038859

Gene Name

BAI1-associated protein 2-like 1

Synonyms

IRTKS, 1300006M19Rik

MMRRC Submission

043140-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5586 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

144264526-144358112 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 144282139 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 220 (S220P)

Ref Sequence

ENSEMBL: ENSMUSP00000053129 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055190] [ENSMUST00000155491]

AlphaFold

Q9DBJ3

PDB Structure

Solution Structure of RSGI RUH-010, an SH3 Domain from Mouse cDNA [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000055190
AA Change: S220P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000053129
Gene: ENSMUSG00000038859
AA Change: S220P

Domain	Start	End	E-Value	Type
Pfam:IMD	16	236	4.4e-65	PFAM
SH3	343	402	1.42e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129287

Predicted Effect

probably benign
Transcript: ENSMUST00000155491

SMART Domains

Protein: ENSMUSP00000122016
Gene: ENSMUSG00000047843

Domain	Start	End	E-Value	Type
Pfam:DUF2367	27	90	1.1e-24	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156467

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198873

Meta Mutation Damage Score

0.4661

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.0%

Validation Efficiency

98% (101/103)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IMD (IRSp53/MIM homology domain) family. Members of this family can be subdivided in two groups, the IRSp53-like and MIM-like, based on the presence or absence of the SH3 (Src homology 3) domain. The protein encoded by this gene contains a conserved IMD, also known as F-actin bundling domain, at the N-terminus, and a canonical SH3 domain near the C-terminus, so it belongs to the IRSp53-like group. This protein is the substrate for insulin receptor tyrosine kinase and binds to the small GTPase Rac. It is involved in signal transduction pathways that link deformation of the plasma membrane and remodeling of the actin cytoskeleton. It also promotes actin assembly and membrane protrusions when overexpressed in mammalian cells, and is essential to the formation of a potent actin assembly complex during EHEC (Enterohemorrhagic Escherichia coli) pedestal formation. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased circulating glucose and insulin levels, impaired glucose tolerance and insulin resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	G	7: 29,577,728		noncoding transcript	Het
Aaas	A	T	15: 102,346,676		probably null	Het
Abcc3	G	A	11: 94,364,421	R600W	probably damaging	Het
Abhd13	A	T	8: 9,988,318	Q305L	probably benign	Het
Adcy5	A	T	16: 35,157,116	I340F	probably damaging	Het
Adgrl3	T	A	5: 81,724,147	I964N	probably damaging	Het
Anks1b	T	A	10: 90,077,064	H316Q	probably damaging	Het
Ap3d1	A	T	10: 80,719,130	F454I	possibly damaging	Het
Apol7c	T	C	15: 77,526,399	R116G	possibly damaging	Het
Arhgap5	A	G	12: 52,519,912	E1222G	possibly damaging	Het
AW551984	A	G	9: 39,591,263	V673A	probably benign	Het
Bcl6	A	G	16: 23,973,176	F143L	probably benign	Het
Calb1	A	T	4: 15,900,811	T165S	probably benign	Het
Ccdc66	C	A	14: 27,506,711	G6C	probably damaging	Het
Ccdc88a	A	G	11: 29,503,484	I344V	probably benign	Het
Cdh19	T	A	1: 110,929,857	D249V	probably damaging	Het
Ces1c	T	A	8: 93,127,599	T103S	probably benign	Het
Cfap54	T	A	10: 92,972,611	K1401*	probably null	Het
Copa	T	A	1: 172,105,222	N371K	probably damaging	Het
Cyp2b10	A	T	7: 25,917,012	Y348F	probably damaging	Het
Dennd5a	T	C	7: 109,905,721	R861G	possibly damaging	Het
Dhx8	T	C	11: 101,733,036		probably benign	Het
Dido1	C	T	2: 180,659,652	W2153*	probably null	Het
Dlgap1	T	A	17: 70,818,161	V969D	probably damaging	Het
Dvl3	A	G	16: 20,517,289	D32G	probably damaging	Het
Epdr1	T	C	13: 19,594,548	D24G	probably benign	Het
Etnk2	T	A	1: 133,379,305		probably null	Het
Fam129a	C	T	1: 151,717,556	T664I	probably benign	Het
Fhad1	C	T	4: 141,905,131	M1232I	probably benign	Het
Gcnt2	A	C	13: 40,860,953	E200A	probably damaging	Het
Gm12800	T	A	4: 101,910,120	F189I	probably benign	Het
Gm5174	A	G	10: 86,656,545		noncoding transcript	Het
Gm6408	T	A	5: 146,484,457	F299I	possibly damaging	Het
Gpr85	G	T	6: 13,836,001	Y301*	probably null	Het
Gucy2e	G	T	11: 69,226,256	P780T	probably damaging	Het
Icam5	A	T	9: 21,034,820	N316I	probably damaging	Het
Ifit1bl1	C	T	19: 34,594,277	R260Q	probably damaging	Het
Il1r1	A	C	1: 40,225,251		probably benign	Het
Kif3c	A	T	12: 3,389,656	I86F	probably benign	Het
Klhdc2	A	G	12: 69,307,693		probably null	Het
Mast2	A	G	4: 116,435,563	L9P	probably damaging	Het
Mcoln1	G	T	8: 3,510,389	C316F	probably damaging	Het
Mon1a	A	T	9: 107,898,695	D4V	probably damaging	Het
Ms4a18	T	A	19: 11,013,674	M19L	probably benign	Het
Nbea	T	C	3: 55,631,971	K2790E	probably benign	Het
Noc3l	C	T	19: 38,814,695	E167K	possibly damaging	Het
Nol10	G	A	12: 17,416,828	E570K	possibly damaging	Het
Nr2e3	T	C	9: 59,949,201	R69G	probably damaging	Het
Obscn	G	A	11: 59,001,468	R1358*	probably null	Het
Olfr115	A	T	17: 37,610,254	F166I	probably damaging	Het
Olfr1472	A	T	19: 13,454,382	M45K	probably benign	Het
Olfr1535	C	A	13: 21,555,096	V309F	probably damaging	Het
Olfr675	A	G	7: 105,024,221	I253T	probably damaging	Het
Pak2	A	T	16: 32,041,519	D175E	probably benign	Het
Pccb	C	T	9: 100,985,803	V357I	possibly damaging	Het
Pcdhb4	C	T	18: 37,308,981	P448L	probably damaging	Het
Pcdhb9	A	G	18: 37,401,114	M54V	probably benign	Het
Ppp3cb	A	G	14: 20,520,690		probably benign	Het
Ppp4r1	A	G	17: 65,824,568	D452G	probably benign	Het
Prmt3	T	A	7: 49,826,751	D369E	probably damaging	Het
Psmd12	T	A	11: 107,486,475	V120D	probably benign	Het
Ptprb	T	C	10: 116,353,827	L1797P	probably damaging	Het
Ptprm	A	G	17: 66,920,196	S653P	probably damaging	Het
Pxdn	T	A	12: 30,003,142	V926D	probably damaging	Het
Retreg3	T	G	11: 101,106,339	Q105P	probably damaging	Het
Sacs	A	T	14: 61,206,441	R1979*	probably null	Het
Scn2a	T	A	2: 65,707,295	L696*	probably null	Het
Sema3c	A	T	5: 17,711,424	N465Y	probably damaging	Het
Slc25a32	A	T	15: 39,099,913	V171E	possibly damaging	Het
Slc30a7	C	T	3: 115,990,051	V158I	probably benign	Het
Slc44a5	G	A	3: 154,270,165		probably benign	Het
Slc4a8	A	G	15: 100,787,164	D140G	probably damaging	Het
Slc7a11	G	A	3: 50,443,083	S60L	possibly damaging	Het
Spryd3	A	T	15: 102,131,937	H59Q	probably benign	Het
Sqstm1	T	C	11: 50,203,022	D256G	probably damaging	Het
Sst	A	T	16: 23,889,737	S115T	probably damaging	Het
Surf1	T	C	2: 26,915,951		probably benign	Het
Synj1	A	T	16: 91,009,977		probably benign	Het
Tet1	C	A	10: 62,878,294	C574F	probably damaging	Het
Thnsl1	T	A	2: 21,212,390	Y318*	probably null	Het
Tmem110	A	G	14: 30,870,819	K166E	probably damaging	Het
Tomm70a	A	G	16: 57,122,130	E90G	probably damaging	Het
Treml4	A	G	17: 48,264,899	D110G	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Txnl1	C	T	18: 63,664,325	G283D	probably damaging	Het
Uba6	T	C	5: 86,135,047	D559G	probably damaging	Het
Usp4	T	C	9: 108,356,462	V94A	possibly damaging	Het
Vmn2r25	A	C	6: 123,825,296	C549W	probably damaging	Het
Vmn2r59	G	T	7: 42,045,681	Q436K	probably benign	Het
Wdr70	A	T	15: 7,884,288	Y627N	possibly damaging	Het
Xpr1	T	C	1: 155,312,863	I344V	probably benign	Het
Zfp423	T	A	8: 87,859,340	Q61L	possibly damaging	Het

Other mutations in Baiap2l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00789:Baiap2l1	APN	5	144285546	nonsense	probably null
IGL00789:Baiap2l1	APN	5	144286069	splice site	probably null
IGL00922:Baiap2l1	APN	5	144318967	missense	probably damaging	1.00
IGL01446:Baiap2l1	APN	5	144275913	missense	probably benign	0.10
IGL01603:Baiap2l1	APN	5	144280815	intron	probably benign
IGL02748:Baiap2l1	APN	5	144266605	intron	probably benign
IGL03348:Baiap2l1	APN	5	144278531	missense	probably benign	0.08
PIT4382001:Baiap2l1	UTSW	5	144278670	missense	possibly damaging	0.71
R0066:Baiap2l1	UTSW	5	144284562	missense	probably damaging	1.00
R0066:Baiap2l1	UTSW	5	144284562	missense	probably damaging	1.00
R0110:Baiap2l1	UTSW	5	144275891	missense	probably damaging	1.00
R0197:Baiap2l1	UTSW	5	144266010	missense	probably damaging	0.96
R0469:Baiap2l1	UTSW	5	144275891	missense	probably damaging	1.00
R0744:Baiap2l1	UTSW	5	144266641	missense	probably benign	0.21
R0755:Baiap2l1	UTSW	5	144284557	missense	probably damaging	0.97
R0765:Baiap2l1	UTSW	5	144277703	missense	probably damaging	0.99
R1051:Baiap2l1	UTSW	5	144286133	missense	probably damaging	1.00
R1809:Baiap2l1	UTSW	5	144324555	critical splice donor site	probably null
R3889:Baiap2l1	UTSW	5	144278535	missense	possibly damaging	0.67
R4451:Baiap2l1	UTSW	5	144278552	missense	probably damaging	1.00
R5093:Baiap2l1	UTSW	5	144278553	missense	probably damaging	1.00
R5471:Baiap2l1	UTSW	5	144282141	missense	probably benign	0.01
R5523:Baiap2l1	UTSW	5	144275958	missense	probably damaging	1.00
R5524:Baiap2l1	UTSW	5	144280949	missense	probably benign	0.01
R5603:Baiap2l1	UTSW	5	144265977	missense	probably damaging	1.00
R5735:Baiap2l1	UTSW	5	144286302	missense	probably damaging	1.00
R6353:Baiap2l1	UTSW	5	144282088	missense	possibly damaging	0.80
R6572:Baiap2l1	UTSW	5	144286302	missense	probably damaging	1.00
R6619:Baiap2l1	UTSW	5	144286106	missense	probably benign	0.22
R6981:Baiap2l1	UTSW	5	144285579	missense	possibly damaging	0.94
R7218:Baiap2l1	UTSW	5	144275877	missense	probably benign	0.01
R7352:Baiap2l1	UTSW	5	144324626	missense	probably benign	0.03
R7662:Baiap2l1	UTSW	5	144357890	intron	probably benign
R7797:Baiap2l1	UTSW	5	144318950	missense	probably damaging	1.00
R7981:Baiap2l1	UTSW	5	144357890	intron	probably benign
R8170:Baiap2l1	UTSW	5	144277692	nonsense	probably null
R8308:Baiap2l1	UTSW	5	144277677	missense	probably benign	0.06
R8333:Baiap2l1	UTSW	5	144280881	missense	possibly damaging	0.89
R8673:Baiap2l1	UTSW	5	144276042	intron	probably benign
R8976:Baiap2l1	UTSW	5	144286307	missense	probably benign	0.03
R9187:Baiap2l1	UTSW	5	144280954	missense	probably benign	0.01
X0022:Baiap2l1	UTSW	5	144278652	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGGTCAGTTTGAACTAATGCATAC -3'
(R):5'- GTCTGCCTCTTCAGCAACTG -3'

Sequencing Primer
(F):5'- TGCATACTAGTAAGCATGTAGAAAGG -3'
(R):5'- GACACAGGAGATATTCATAGTTGC -3'

Posted On

2016-10-26