Incidental Mutation 'R5586:Prmt3'
ID438714
Institutional Source Beutler Lab
Gene Symbol Prmt3
Ensembl Gene ENSMUSG00000030505
Gene Nameprotein arginine N-methyltransferase 3
SynonymsHrmt1l3, 2010005E20Rik, 2410018A17Rik
MMRRC Submission 043140-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.679) question?
Stock #R5586 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location49778346-49858265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49826751 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 369 (D369E)
Ref Sequence ENSEMBL: ENSMUSP00000032715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032715] [ENSMUST00000147401]
Predicted Effect probably damaging
Transcript: ENSMUST00000032715
AA Change: D369E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032715
Gene: ENSMUSG00000030505
AA Change: D369E

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
ZnF_C2H2 46 69 2.41e1 SMART
coiled coil region 156 191 N/A INTRINSIC
Pfam:PRMT5 212 508 5.7e-8 PFAM
Pfam:Methyltransf_9 220 392 9.3e-9 PFAM
Pfam:MTS 242 326 5.4e-7 PFAM
Pfam:PrmA 245 343 4.3e-13 PFAM
Pfam:Methyltransf_31 250 407 8.8e-11 PFAM
Pfam:Methyltransf_18 252 360 2.5e-11 PFAM
Pfam:Methyltransf_11 257 356 1.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130907
SMART Domains Protein: ENSMUSP00000114676
Gene: ENSMUSG00000030505

DomainStartEndE-ValueType
PDB:1F3L|A 1 135 3e-93 PDB
SCOP:d1f3la_ 2 135 2e-17 SMART
Blast:FBG 73 118 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000147401
SMART Domains Protein: ENSMUSP00000115155
Gene: ENSMUSG00000030505

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
PDB:1WIR|A 38 64 1e-13 PDB
Blast:ZnF_C2H2 46 64 1e-5 BLAST
Meta Mutation Damage Score 0.264 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protein arginine methyltransferase (PRMT) family. The encoded enzyme catalyzes the methylation of guanidino nitrogens of arginyl residues of proteins. The enzyme acts on 40S ribosomal protein S2 (rpS2), which is its major in-vivo substrate, and is involved in the proper maturation of the 80S ribosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele exhibit a reduced embryonic size but survive birth and attain a normal size in adulthood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,577,728 noncoding transcript Het
Aaas A T 15: 102,346,676 probably null Het
Abcc3 G A 11: 94,364,421 R600W probably damaging Het
Abhd13 A T 8: 9,988,318 Q305L probably benign Het
Adcy5 A T 16: 35,157,116 I340F probably damaging Het
Adgrl3 T A 5: 81,724,147 I964N probably damaging Het
Anks1b T A 10: 90,077,064 H316Q probably damaging Het
Ap3d1 A T 10: 80,719,130 F454I possibly damaging Het
Apol7c T C 15: 77,526,399 R116G possibly damaging Het
Arhgap5 A G 12: 52,519,912 E1222G possibly damaging Het
AW551984 A G 9: 39,591,263 V673A probably benign Het
Baiap2l1 A G 5: 144,282,139 S220P probably damaging Het
Bcl6 A G 16: 23,973,176 F143L probably benign Het
Calb1 A T 4: 15,900,811 T165S probably benign Het
Ccdc66 C A 14: 27,506,711 G6C probably damaging Het
Ccdc88a A G 11: 29,503,484 I344V probably benign Het
Cdh19 T A 1: 110,929,857 D249V probably damaging Het
Ces1c T A 8: 93,127,599 T103S probably benign Het
Cfap54 T A 10: 92,972,611 K1401* probably null Het
Copa T A 1: 172,105,222 N371K probably damaging Het
Cyp2b10 A T 7: 25,917,012 Y348F probably damaging Het
Dennd5a T C 7: 109,905,721 R861G possibly damaging Het
Dhx8 T C 11: 101,733,036 probably benign Het
Dido1 C T 2: 180,659,652 W2153* probably null Het
Dlgap1 T A 17: 70,818,161 V969D probably damaging Het
Dvl3 A G 16: 20,517,289 D32G probably damaging Het
Epdr1 T C 13: 19,594,548 D24G probably benign Het
Etnk2 T A 1: 133,379,305 probably null Het
Fam129a C T 1: 151,717,556 T664I probably benign Het
Fhad1 C T 4: 141,905,131 M1232I probably benign Het
Gcnt2 A C 13: 40,860,953 E200A probably damaging Het
Gm12800 T A 4: 101,910,120 F189I probably benign Het
Gm5174 A G 10: 86,656,545 noncoding transcript Het
Gm6408 T A 5: 146,484,457 F299I possibly damaging Het
Gpr85 G T 6: 13,836,001 Y301* probably null Het
Gucy2e G T 11: 69,226,256 P780T probably damaging Het
Icam5 A T 9: 21,034,820 N316I probably damaging Het
Ifit1bl1 C T 19: 34,594,277 R260Q probably damaging Het
Il1r1 A C 1: 40,225,251 probably benign Het
Kif3c A T 12: 3,389,656 I86F probably benign Het
Klhdc2 A G 12: 69,307,693 probably null Het
Mast2 A G 4: 116,435,563 L9P probably damaging Het
Mcoln1 G T 8: 3,510,389 C316F probably damaging Het
Mon1a A T 9: 107,898,695 D4V probably damaging Het
Ms4a18 T A 19: 11,013,674 M19L probably benign Het
Nbea T C 3: 55,631,971 K2790E probably benign Het
Noc3l C T 19: 38,814,695 E167K possibly damaging Het
Nol10 G A 12: 17,416,828 E570K possibly damaging Het
Nr2e3 T C 9: 59,949,201 R69G probably damaging Het
Obscn G A 11: 59,001,468 R1358* probably null Het
Olfr115 A T 17: 37,610,254 F166I probably damaging Het
Olfr1472 A T 19: 13,454,382 M45K probably benign Het
Olfr1535 C A 13: 21,555,096 V309F probably damaging Het
Olfr675 A G 7: 105,024,221 I253T probably damaging Het
Pak2 A T 16: 32,041,519 D175E probably benign Het
Pccb C T 9: 100,985,803 V357I possibly damaging Het
Pcdhb4 C T 18: 37,308,981 P448L probably damaging Het
Pcdhb9 A G 18: 37,401,114 M54V probably benign Het
Ppp3cb A G 14: 20,520,690 probably benign Het
Ppp4r1 A G 17: 65,824,568 D452G probably benign Het
Psmd12 T A 11: 107,486,475 V120D probably benign Het
Ptprb T C 10: 116,353,827 L1797P probably damaging Het
Ptprm A G 17: 66,920,196 S653P probably damaging Het
Pxdn T A 12: 30,003,142 V926D probably damaging Het
Retreg3 T G 11: 101,106,339 Q105P probably damaging Het
Sacs A T 14: 61,206,441 R1979* probably null Het
Scn2a T A 2: 65,707,295 L696* probably null Het
Sema3c A T 5: 17,711,424 N465Y probably damaging Het
Slc25a32 A T 15: 39,099,913 V171E possibly damaging Het
Slc30a7 C T 3: 115,990,051 V158I probably benign Het
Slc44a5 G A 3: 154,270,165 probably benign Het
Slc4a8 A G 15: 100,787,164 D140G probably damaging Het
Slc7a11 G A 3: 50,443,083 S60L possibly damaging Het
Spryd3 A T 15: 102,131,937 H59Q probably benign Het
Sqstm1 T C 11: 50,203,022 D256G probably damaging Het
Sst A T 16: 23,889,737 S115T probably damaging Het
Surf1 T C 2: 26,915,951 probably benign Het
Synj1 A T 16: 91,009,977 probably benign Het
Tet1 C A 10: 62,878,294 C574F probably damaging Het
Thnsl1 T A 2: 21,212,390 Y318* probably null Het
Tmem110 A G 14: 30,870,819 K166E probably damaging Het
Tomm70a A G 16: 57,122,130 E90G probably damaging Het
Treml4 A G 17: 48,264,899 D110G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl1 C T 18: 63,664,325 G283D probably damaging Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Usp4 T C 9: 108,356,462 V94A possibly damaging Het
Vmn2r25 A C 6: 123,825,296 C549W probably damaging Het
Vmn2r59 G T 7: 42,045,681 Q436K probably benign Het
Wdr70 A T 15: 7,884,288 Y627N possibly damaging Het
Xpr1 T C 1: 155,312,863 I344V probably benign Het
Zfp423 T A 8: 87,859,340 Q61L possibly damaging Het
Other mutations in Prmt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Prmt3 APN 7 49792009 missense probably damaging 1.00
IGL01444:Prmt3 APN 7 49780372 missense probably benign 0.00
IGL01688:Prmt3 APN 7 49848732 splice site probably null
IGL02041:Prmt3 APN 7 49828963 missense possibly damaging 0.91
IGL02304:Prmt3 APN 7 49826737 missense probably benign 0.44
IGL02389:Prmt3 APN 7 49848758 nonsense probably null
IGL02879:Prmt3 APN 7 49818063 missense probably benign 0.39
K7894:Prmt3 UTSW 7 49826711 missense probably damaging 1.00
R0616:Prmt3 UTSW 7 49787328 missense probably damaging 1.00
R0667:Prmt3 UTSW 7 49791995 missense probably damaging 1.00
R1170:Prmt3 UTSW 7 49848547 critical splice donor site probably null
R1343:Prmt3 UTSW 7 49818108 missense probably benign 0.19
R1562:Prmt3 UTSW 7 49826854 missense probably benign 0.00
R1614:Prmt3 UTSW 7 49826719 missense possibly damaging 0.95
R1777:Prmt3 UTSW 7 49798346 missense possibly damaging 0.92
R3113:Prmt3 UTSW 7 49782012 missense probably damaging 1.00
R4170:Prmt3 UTSW 7 49826776 missense probably benign 0.01
R4403:Prmt3 UTSW 7 49780357 missense probably damaging 1.00
R4463:Prmt3 UTSW 7 49818089 missense probably damaging 1.00
R4962:Prmt3 UTSW 7 49826809 missense probably benign 0.00
R5144:Prmt3 UTSW 7 49786135 missense possibly damaging 0.48
R5364:Prmt3 UTSW 7 49848806 missense probably damaging 1.00
R5624:Prmt3 UTSW 7 49780334 missense probably damaging 0.97
R5820:Prmt3 UTSW 7 49848806 missense probably damaging 1.00
R5992:Prmt3 UTSW 7 49828947 missense probably benign 0.00
R6931:Prmt3 UTSW 7 49829016 missense probably benign 0.00
R7117:Prmt3 UTSW 7 49818095 missense probably benign 0.00
X0064:Prmt3 UTSW 7 49781974 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACTGGGGTAACTCTATCTCCTG -3'
(R):5'- TTTTACCTGAACCAAGCATCTAGC -3'

Sequencing Primer
(F):5'- GGGGTAACTCTATCTCCTGTCTTC -3'
(R):5'- CTTATGCAGGGAGTCCAAGCATC -3'
Posted On2016-10-26