Incidental Mutation 'R5586:Mcoln1'
ID 438717
Institutional Source Beutler Lab
Gene Symbol Mcoln1
Ensembl Gene ENSMUSG00000004567
Gene Name mucolipin 1
Synonyms 2210015I05Rik, mucolipidin, TRPML1
MMRRC Submission 043140-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.193) question?
Stock # R5586 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 3550458-3565232 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 3560389 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 316 (C316F)
Ref Sequence ENSEMBL: ENSMUSP00000004683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004681] [ENSMUST00000004683] [ENSMUST00000111070] [ENSMUST00000160338] [ENSMUST00000208306] [ENSMUST00000208359]
AlphaFold Q99J21
Predicted Effect probably benign
Transcript: ENSMUST00000004681
SMART Domains Protein: ENSMUSP00000004681
Gene: ENSMUSG00000004565

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
cNMP 147 272 3.17e-13 SMART
cNMP 465 584 3.17e-4 SMART
cNMP 587 703 3.45e-5 SMART
Blast:cNMP 742 777 7e-11 BLAST
Pfam:Patatin 933 1099 5e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000004683
AA Change: C316F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000004683
Gene: ENSMUSG00000004567
AA Change: C316F

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 348 370 N/A INTRINSIC
Pfam:PKD_channel 378 524 2.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111070
SMART Domains Protein: ENSMUSP00000106699
Gene: ENSMUSG00000004565

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
cNMP 147 272 3.17e-13 SMART
cNMP 465 584 3.17e-4 SMART
cNMP 587 703 3.45e-5 SMART
Blast:cNMP 742 777 7e-11 BLAST
Pfam:Patatin 933 1099 1.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159808
Predicted Effect probably benign
Transcript: ENSMUST00000160338
SMART Domains Protein: ENSMUSP00000123717
Gene: ENSMUSG00000004567

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161842
Predicted Effect probably benign
Transcript: ENSMUST00000208943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162797
Predicted Effect probably benign
Transcript: ENSMUST00000208306
Predicted Effect probably benign
Transcript: ENSMUST00000208359
Meta Mutation Damage Score 0.9438 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a memberof the transient receptor potential (TRP) cation channel gene family. The transmembrane protein localizes to intracellular vesicular membranes including lysosomes, and functions in the late endocytic pathway and in the regulation of lysosomal exocytosis. The channel is permeable to Ca(2+), Fe(2+), Na(+), K(+), and H(+), and is modulated by changes in Ca(2+) concentration. Mutations in this gene result in mucolipidosis type IV. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit premature death around 8 months of age preceeded by weight loss, weakness, lethargy, bladder and stomach distension, and retinal degradation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,277,153 (GRCm39) noncoding transcript Het
Aaas A T 15: 102,255,111 (GRCm39) probably null Het
Abcc3 G A 11: 94,255,247 (GRCm39) R600W probably damaging Het
Abhd13 A T 8: 10,038,318 (GRCm39) Q305L probably benign Het
Adcy5 A T 16: 34,977,486 (GRCm39) I340F probably damaging Het
Adgrl3 T A 5: 81,871,994 (GRCm39) I964N probably damaging Het
Anks1b T A 10: 89,912,926 (GRCm39) H316Q probably damaging Het
Ap3d1 A T 10: 80,554,964 (GRCm39) F454I possibly damaging Het
Apol7c T C 15: 77,410,599 (GRCm39) R116G possibly damaging Het
Arhgap5 A G 12: 52,566,695 (GRCm39) E1222G possibly damaging Het
AW551984 A G 9: 39,502,559 (GRCm39) V673A probably benign Het
Baiap2l1 A G 5: 144,218,949 (GRCm39) S220P probably damaging Het
Bcl6 A G 16: 23,791,926 (GRCm39) F143L probably benign Het
Calb1 A T 4: 15,900,811 (GRCm39) T165S probably benign Het
Ccdc66 C A 14: 27,228,668 (GRCm39) G6C probably damaging Het
Ccdc88a A G 11: 29,453,484 (GRCm39) I344V probably benign Het
Cdh19 T A 1: 110,857,587 (GRCm39) D249V probably damaging Het
Ces1c T A 8: 93,854,227 (GRCm39) T103S probably benign Het
Cfap54 T A 10: 92,808,473 (GRCm39) K1401* probably null Het
Copa T A 1: 171,932,789 (GRCm39) N371K probably damaging Het
Cyp2b10 A T 7: 25,616,437 (GRCm39) Y348F probably damaging Het
Dennd5a T C 7: 109,504,928 (GRCm39) R861G possibly damaging Het
Dhx8 T C 11: 101,623,862 (GRCm39) probably benign Het
Dido1 C T 2: 180,301,445 (GRCm39) W2153* probably null Het
Dlgap1 T A 17: 71,125,156 (GRCm39) V969D probably damaging Het
Dvl3 A G 16: 20,336,039 (GRCm39) D32G probably damaging Het
Epdr1 T C 13: 19,778,718 (GRCm39) D24G probably benign Het
Etnk2 T A 1: 133,307,043 (GRCm39) probably null Het
Fhad1 C T 4: 141,632,442 (GRCm39) M1232I probably benign Het
Gcnt2 A C 13: 41,014,429 (GRCm39) E200A probably damaging Het
Gm5174 A G 10: 86,492,409 (GRCm39) noncoding transcript Het
Gm6408 T A 5: 146,421,267 (GRCm39) F299I possibly damaging Het
Gpr85 G T 6: 13,836,000 (GRCm39) Y301* probably null Het
Gucy2e G T 11: 69,117,082 (GRCm39) P780T probably damaging Het
Icam5 A T 9: 20,946,116 (GRCm39) N316I probably damaging Het
Ifit1bl1 C T 19: 34,571,677 (GRCm39) R260Q probably damaging Het
Il1r1 A C 1: 40,264,411 (GRCm39) probably benign Het
Kif3c A T 12: 3,439,656 (GRCm39) I86F probably benign Het
Klhdc2 A G 12: 69,354,467 (GRCm39) probably null Het
Mast2 A G 4: 116,292,760 (GRCm39) L9P probably damaging Het
Mon1a A T 9: 107,775,894 (GRCm39) D4V probably damaging Het
Ms4a18 T A 19: 10,991,038 (GRCm39) M19L probably benign Het
Nbea T C 3: 55,539,392 (GRCm39) K2790E probably benign Het
Niban1 C T 1: 151,593,307 (GRCm39) T664I probably benign Het
Noc3l C T 19: 38,803,139 (GRCm39) E167K possibly damaging Het
Nol10 G A 12: 17,466,829 (GRCm39) E570K possibly damaging Het
Nr2e3 T C 9: 59,856,484 (GRCm39) R69G probably damaging Het
Obscn G A 11: 58,892,294 (GRCm39) R1358* probably null Het
Or14j4 A T 17: 37,921,145 (GRCm39) F166I probably damaging Het
Or2b7 C A 13: 21,739,266 (GRCm39) V309F probably damaging Het
Or52e8b A G 7: 104,673,428 (GRCm39) I253T probably damaging Het
Or5b117 A T 19: 13,431,746 (GRCm39) M45K probably benign Het
Pak2 A T 16: 31,860,337 (GRCm39) D175E probably benign Het
Pccb C T 9: 100,867,856 (GRCm39) V357I possibly damaging Het
Pcdhb4 C T 18: 37,442,034 (GRCm39) P448L probably damaging Het
Pcdhb9 A G 18: 37,534,167 (GRCm39) M54V probably benign Het
Ppp3cb A G 14: 20,570,758 (GRCm39) probably benign Het
Ppp4r1 A G 17: 66,131,563 (GRCm39) D452G probably benign Het
Pramel18 T A 4: 101,767,317 (GRCm39) F189I probably benign Het
Prmt3 T A 7: 49,476,499 (GRCm39) D369E probably damaging Het
Psmd12 T A 11: 107,377,301 (GRCm39) V120D probably benign Het
Ptprb T C 10: 116,189,732 (GRCm39) L1797P probably damaging Het
Ptprm A G 17: 67,227,191 (GRCm39) S653P probably damaging Het
Pxdn T A 12: 30,053,141 (GRCm39) V926D probably damaging Het
Retreg3 T G 11: 100,997,165 (GRCm39) Q105P probably damaging Het
Sacs A T 14: 61,443,890 (GRCm39) R1979* probably null Het
Scn2a T A 2: 65,537,639 (GRCm39) L696* probably null Het
Sema3c A T 5: 17,916,422 (GRCm39) N465Y probably damaging Het
Slc25a32 A T 15: 38,963,308 (GRCm39) V171E possibly damaging Het
Slc30a7 C T 3: 115,783,700 (GRCm39) V158I probably benign Het
Slc44a5 G A 3: 153,975,802 (GRCm39) probably benign Het
Slc4a8 A G 15: 100,685,045 (GRCm39) D140G probably damaging Het
Slc7a11 G A 3: 50,397,532 (GRCm39) S60L possibly damaging Het
Spryd3 A T 15: 102,040,372 (GRCm39) H59Q probably benign Het
Sqstm1 T C 11: 50,093,849 (GRCm39) D256G probably damaging Het
Sst A T 16: 23,708,487 (GRCm39) S115T probably damaging Het
Stimate A G 14: 30,592,776 (GRCm39) K166E probably damaging Het
Surf1 T C 2: 26,805,963 (GRCm39) probably benign Het
Synj1 A T 16: 90,806,865 (GRCm39) probably benign Het
Tet1 C A 10: 62,714,073 (GRCm39) C574F probably damaging Het
Thnsl1 T A 2: 21,217,201 (GRCm39) Y318* probably null Het
Tomm70a A G 16: 56,942,493 (GRCm39) E90G probably damaging Het
Treml4 A G 17: 48,571,927 (GRCm39) D110G probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Txnl1 C T 18: 63,797,396 (GRCm39) G283D probably damaging Het
Uba6 T C 5: 86,282,906 (GRCm39) D559G probably damaging Het
Usp4 T C 9: 108,233,661 (GRCm39) V94A possibly damaging Het
Vmn2r25 A C 6: 123,802,255 (GRCm39) C549W probably damaging Het
Vmn2r59 G T 7: 41,695,105 (GRCm39) Q436K probably benign Het
Wdr70 A T 15: 7,913,769 (GRCm39) Y627N possibly damaging Het
Xpr1 T C 1: 155,188,609 (GRCm39) I344V probably benign Het
Zfp423 T A 8: 88,585,968 (GRCm39) Q61L possibly damaging Het
Other mutations in Mcoln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Mcoln1 APN 8 3,557,558 (GRCm39) missense possibly damaging 0.89
IGL01621:Mcoln1 APN 8 3,560,910 (GRCm39) missense probably damaging 1.00
IGL02147:Mcoln1 APN 8 3,558,379 (GRCm39) missense probably benign
IGL02156:Mcoln1 APN 8 3,562,657 (GRCm39) nonsense probably null
R0616:Mcoln1 UTSW 8 3,565,025 (GRCm39) missense probably benign 0.00
R1498:Mcoln1 UTSW 8 3,562,861 (GRCm39) missense probably damaging 1.00
R2102:Mcoln1 UTSW 8 3,561,731 (GRCm39) missense probably damaging 1.00
R2155:Mcoln1 UTSW 8 3,561,787 (GRCm39) missense probably damaging 1.00
R2178:Mcoln1 UTSW 8 3,558,766 (GRCm39) missense probably damaging 1.00
R2218:Mcoln1 UTSW 8 3,555,813 (GRCm39) missense possibly damaging 0.50
R3828:Mcoln1 UTSW 8 3,550,601 (GRCm39) missense possibly damaging 0.93
R3875:Mcoln1 UTSW 8 3,558,355 (GRCm39) missense probably benign
R3971:Mcoln1 UTSW 8 3,557,408 (GRCm39) missense probably benign 0.01
R4621:Mcoln1 UTSW 8 3,555,923 (GRCm39) missense probably damaging 1.00
R4622:Mcoln1 UTSW 8 3,555,923 (GRCm39) missense probably damaging 1.00
R4659:Mcoln1 UTSW 8 3,560,840 (GRCm39) missense probably damaging 1.00
R4873:Mcoln1 UTSW 8 3,557,422 (GRCm39) missense probably benign 0.00
R4875:Mcoln1 UTSW 8 3,557,422 (GRCm39) missense probably benign 0.00
R4914:Mcoln1 UTSW 8 3,557,483 (GRCm39) nonsense probably null
R5114:Mcoln1 UTSW 8 3,560,697 (GRCm39) unclassified probably benign
R5876:Mcoln1 UTSW 8 3,560,910 (GRCm39) missense probably damaging 1.00
R5946:Mcoln1 UTSW 8 3,558,701 (GRCm39) missense probably damaging 1.00
R6520:Mcoln1 UTSW 8 3,555,855 (GRCm39) missense probably damaging 1.00
R7449:Mcoln1 UTSW 8 3,557,285 (GRCm39) missense probably damaging 0.98
R7712:Mcoln1 UTSW 8 3,555,873 (GRCm39) missense probably damaging 0.99
R7904:Mcoln1 UTSW 8 3,558,356 (GRCm39) missense probably benign
R7936:Mcoln1 UTSW 8 3,555,924 (GRCm39) missense probably damaging 1.00
R8058:Mcoln1 UTSW 8 3,558,378 (GRCm39) missense probably benign
R8082:Mcoln1 UTSW 8 3,557,420 (GRCm39) missense probably benign 0.01
R8093:Mcoln1 UTSW 8 3,558,740 (GRCm39) missense possibly damaging 0.95
R9090:Mcoln1 UTSW 8 3,555,771 (GRCm39) missense probably damaging 1.00
R9271:Mcoln1 UTSW 8 3,555,771 (GRCm39) missense probably damaging 1.00
R9689:Mcoln1 UTSW 8 3,557,436 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCATACCAGTGTTCATCAGGG -3'
(R):5'- CGTTCCCAGAGGCTGATTTC -3'

Sequencing Primer
(F):5'- AGGGATTTTTGACACTCTCCATG -3'
(R):5'- AGAGGCTGATTTCCCGACC -3'
Posted On 2016-10-26