Incidental Mutation 'R5586:Zfp423'
ID438719
Institutional Source Beutler Lab
Gene Symbol Zfp423
Ensembl Gene ENSMUSG00000045333
Gene Namezinc finger protein 423
SynonymsZfp104, ataxia1, Ebfaz, Roaz
MMRRC Submission 043140-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.864) question?
Stock #R5586 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location87661810-87959595 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87859340 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 61 (Q61L)
Ref Sequence ENSEMBL: ENSMUSP00000052379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052250] [ENSMUST00000109655] [ENSMUST00000174764]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052250
AA Change: Q61L

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052379
Gene: ENSMUSG00000045333
AA Change: Q61L

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
ZnF_C2H2 54 75 5.07e0 SMART
low complexity region 107 123 N/A INTRINSIC
ZnF_C2H2 125 147 1.28e-3 SMART
ZnF_C2H2 153 175 1.64e-1 SMART
ZnF_C2H2 181 203 2.05e-2 SMART
ZnF_C2H2 209 231 3.21e-4 SMART
ZnF_C2H2 250 273 5.42e-2 SMART
ZnF_C2H2 282 305 1.76e-1 SMART
ZnF_C2H2 310 332 8.67e-1 SMART
low complexity region 350 364 N/A INTRINSIC
ZnF_C2H2 396 420 1.16e-1 SMART
ZnF_C2H2 428 451 3.52e-1 SMART
ZnF_C2H2 467 490 7.9e-4 SMART
low complexity region 492 503 N/A INTRINSIC
ZnF_C2H2 504 527 2.53e-2 SMART
ZnF_C2H2 550 575 3.99e0 SMART
low complexity region 591 602 N/A INTRINSIC
ZnF_C2H2 619 641 3.16e-3 SMART
ZnF_C2H2 649 671 5.81e-2 SMART
ZnF_C2H2 679 702 4.87e-4 SMART
ZnF_C2H2 707 730 7.26e-3 SMART
ZnF_C2H2 737 760 4.79e-3 SMART
ZnF_C2H2 768 790 1.36e-2 SMART
ZnF_C2H2 794 817 4.72e-2 SMART
ZnF_C2H2 873 896 4.12e0 SMART
ZnF_C2H2 917 939 5.59e-4 SMART
ZnF_C2H2 946 968 6.42e-4 SMART
ZnF_C2H2 975 997 4.94e0 SMART
ZnF_C2H2 1007 1029 4.99e1 SMART
Pfam:zf-C2H2_6 1050 1068 1.6e-1 PFAM
ZnF_C2H2 1107 1130 1.12e-3 SMART
ZnF_C2H2 1155 1177 1.45e-2 SMART
ZnF_C2H2 1185 1207 5.72e-1 SMART
ZnF_C2H2 1216 1239 1.18e-2 SMART
ZnF_C2H2 1246 1269 4.05e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109655
AA Change: Q82L

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105282
Gene: ENSMUSG00000045333
AA Change: Q82L

DomainStartEndE-ValueType
low complexity region 60 72 N/A INTRINSIC
ZnF_C2H2 75 96 5.07e0 SMART
low complexity region 128 144 N/A INTRINSIC
ZnF_C2H2 146 168 1.28e-3 SMART
ZnF_C2H2 174 196 1.64e-1 SMART
ZnF_C2H2 202 224 2.05e-2 SMART
ZnF_C2H2 230 252 3.21e-4 SMART
ZnF_C2H2 271 294 5.42e-2 SMART
ZnF_C2H2 303 326 1.76e-1 SMART
ZnF_C2H2 331 353 8.67e-1 SMART
low complexity region 371 385 N/A INTRINSIC
ZnF_C2H2 417 441 1.16e-1 SMART
ZnF_C2H2 449 472 3.52e-1 SMART
ZnF_C2H2 488 511 7.9e-4 SMART
low complexity region 513 524 N/A INTRINSIC
ZnF_C2H2 525 548 2.53e-2 SMART
ZnF_C2H2 571 596 3.99e0 SMART
low complexity region 612 623 N/A INTRINSIC
ZnF_C2H2 640 662 3.16e-3 SMART
ZnF_C2H2 670 692 5.81e-2 SMART
ZnF_C2H2 700 723 4.87e-4 SMART
ZnF_C2H2 728 751 7.26e-3 SMART
ZnF_C2H2 758 781 4.79e-3 SMART
ZnF_C2H2 789 811 1.36e-2 SMART
ZnF_C2H2 815 838 4.72e-2 SMART
ZnF_C2H2 894 917 4.12e0 SMART
ZnF_C2H2 938 960 5.59e-4 SMART
ZnF_C2H2 967 989 6.42e-4 SMART
ZnF_C2H2 996 1018 4.94e0 SMART
ZnF_C2H2 1028 1050 4.99e1 SMART
ZnF_C2H2 1128 1151 1.12e-3 SMART
ZnF_C2H2 1176 1198 1.45e-2 SMART
ZnF_C2H2 1206 1228 5.72e-1 SMART
ZnF_C2H2 1237 1260 1.18e-2 SMART
ZnF_C2H2 1267 1290 4.05e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173725
Predicted Effect possibly damaging
Transcript: ENSMUST00000174764
AA Change: Q85L

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134575
Gene: ENSMUSG00000045333
AA Change: Q85L

DomainStartEndE-ValueType
low complexity region 63 75 N/A INTRINSIC
ZnF_C2H2 78 99 5.07e0 SMART
low complexity region 131 147 N/A INTRINSIC
ZnF_C2H2 149 171 1.28e-3 SMART
ZnF_C2H2 177 199 1.64e-1 SMART
ZnF_C2H2 205 227 2.05e-2 SMART
Pfam:zf-C2H2_6 232 244 2.5e-1 PFAM
Meta Mutation Damage Score 0.1316 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear protein that belongs to the family of Kruppel-like C2H2 zinc finger proteins. It functions as a DNA-binding transcription factor by using distinct zinc fingers in different signaling pathways. Thus, it is thought that this gene may have multiple roles in signal transduction during development. Mutations in this gene are associated with nephronophthisis-14 and Joubert syndrome-19. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mutations in this gene lead to postnatal lethality, abnormal gait, ataxia, reduced body size, loss of the corpus callosum, reduction of the hippocampus, olfactory bulb defects, and variable malformation of the cerebellum, including vermis agenesis, due to reduced proliferation of neural precursors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,577,728 noncoding transcript Het
Aaas A T 15: 102,346,676 probably null Het
Abcc3 G A 11: 94,364,421 R600W probably damaging Het
Abhd13 A T 8: 9,988,318 Q305L probably benign Het
Adcy5 A T 16: 35,157,116 I340F probably damaging Het
Adgrl3 T A 5: 81,724,147 I964N probably damaging Het
Anks1b T A 10: 90,077,064 H316Q probably damaging Het
Ap3d1 A T 10: 80,719,130 F454I possibly damaging Het
Apol7c T C 15: 77,526,399 R116G possibly damaging Het
Arhgap5 A G 12: 52,519,912 E1222G possibly damaging Het
AW551984 A G 9: 39,591,263 V673A probably benign Het
Baiap2l1 A G 5: 144,282,139 S220P probably damaging Het
Bcl6 A G 16: 23,973,176 F143L probably benign Het
Calb1 A T 4: 15,900,811 T165S probably benign Het
Ccdc66 C A 14: 27,506,711 G6C probably damaging Het
Ccdc88a A G 11: 29,503,484 I344V probably benign Het
Cdh19 T A 1: 110,929,857 D249V probably damaging Het
Ces1c T A 8: 93,127,599 T103S probably benign Het
Cfap54 T A 10: 92,972,611 K1401* probably null Het
Copa T A 1: 172,105,222 N371K probably damaging Het
Cyp2b10 A T 7: 25,917,012 Y348F probably damaging Het
Dennd5a T C 7: 109,905,721 R861G possibly damaging Het
Dhx8 T C 11: 101,733,036 probably benign Het
Dido1 C T 2: 180,659,652 W2153* probably null Het
Dlgap1 T A 17: 70,818,161 V969D probably damaging Het
Dvl3 A G 16: 20,517,289 D32G probably damaging Het
Epdr1 T C 13: 19,594,548 D24G probably benign Het
Etnk2 T A 1: 133,379,305 probably null Het
Fam129a C T 1: 151,717,556 T664I probably benign Het
Fhad1 C T 4: 141,905,131 M1232I probably benign Het
Gcnt2 A C 13: 40,860,953 E200A probably damaging Het
Gm12800 T A 4: 101,910,120 F189I probably benign Het
Gm5174 A G 10: 86,656,545 noncoding transcript Het
Gm6408 T A 5: 146,484,457 F299I possibly damaging Het
Gpr85 G T 6: 13,836,001 Y301* probably null Het
Gucy2e G T 11: 69,226,256 P780T probably damaging Het
Icam5 A T 9: 21,034,820 N316I probably damaging Het
Ifit1bl1 C T 19: 34,594,277 R260Q probably damaging Het
Il1r1 A C 1: 40,225,251 probably benign Het
Kif3c A T 12: 3,389,656 I86F probably benign Het
Klhdc2 A G 12: 69,307,693 probably null Het
Mast2 A G 4: 116,435,563 L9P probably damaging Het
Mcoln1 G T 8: 3,510,389 C316F probably damaging Het
Mon1a A T 9: 107,898,695 D4V probably damaging Het
Ms4a18 T A 19: 11,013,674 M19L probably benign Het
Nbea T C 3: 55,631,971 K2790E probably benign Het
Noc3l C T 19: 38,814,695 E167K possibly damaging Het
Nol10 G A 12: 17,416,828 E570K possibly damaging Het
Nr2e3 T C 9: 59,949,201 R69G probably damaging Het
Obscn G A 11: 59,001,468 R1358* probably null Het
Olfr115 A T 17: 37,610,254 F166I probably damaging Het
Olfr1472 A T 19: 13,454,382 M45K probably benign Het
Olfr1535 C A 13: 21,555,096 V309F probably damaging Het
Olfr675 A G 7: 105,024,221 I253T probably damaging Het
Pak2 A T 16: 32,041,519 D175E probably benign Het
Pccb C T 9: 100,985,803 V357I possibly damaging Het
Pcdhb4 C T 18: 37,308,981 P448L probably damaging Het
Pcdhb9 A G 18: 37,401,114 M54V probably benign Het
Ppp3cb A G 14: 20,520,690 probably benign Het
Ppp4r1 A G 17: 65,824,568 D452G probably benign Het
Prmt3 T A 7: 49,826,751 D369E probably damaging Het
Psmd12 T A 11: 107,486,475 V120D probably benign Het
Ptprb T C 10: 116,353,827 L1797P probably damaging Het
Ptprm A G 17: 66,920,196 S653P probably damaging Het
Pxdn T A 12: 30,003,142 V926D probably damaging Het
Retreg3 T G 11: 101,106,339 Q105P probably damaging Het
Sacs A T 14: 61,206,441 R1979* probably null Het
Scn2a T A 2: 65,707,295 L696* probably null Het
Sema3c A T 5: 17,711,424 N465Y probably damaging Het
Slc25a32 A T 15: 39,099,913 V171E possibly damaging Het
Slc30a7 C T 3: 115,990,051 V158I probably benign Het
Slc44a5 G A 3: 154,270,165 probably benign Het
Slc4a8 A G 15: 100,787,164 D140G probably damaging Het
Slc7a11 G A 3: 50,443,083 S60L possibly damaging Het
Spryd3 A T 15: 102,131,937 H59Q probably benign Het
Sqstm1 T C 11: 50,203,022 D256G probably damaging Het
Sst A T 16: 23,889,737 S115T probably damaging Het
Surf1 T C 2: 26,915,951 probably benign Het
Synj1 A T 16: 91,009,977 probably benign Het
Tet1 C A 10: 62,878,294 C574F probably damaging Het
Thnsl1 T A 2: 21,212,390 Y318* probably null Het
Tmem110 A G 14: 30,870,819 K166E probably damaging Het
Tomm70a A G 16: 57,122,130 E90G probably damaging Het
Treml4 A G 17: 48,264,899 D110G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl1 C T 18: 63,664,325 G283D probably damaging Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Usp4 T C 9: 108,356,462 V94A possibly damaging Het
Vmn2r25 A C 6: 123,825,296 C549W probably damaging Het
Vmn2r59 G T 7: 42,045,681 Q436K probably benign Het
Wdr70 A T 15: 7,884,288 Y627N possibly damaging Het
Xpr1 T C 1: 155,312,863 I344V probably benign Het
Other mutations in Zfp423
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Zfp423 APN 8 87781611 unclassified probably null
IGL01359:Zfp423 APN 8 87780662 missense probably damaging 1.00
IGL01780:Zfp423 APN 8 87781508 missense probably damaging 1.00
IGL02250:Zfp423 APN 8 87783255 missense probably damaging 1.00
IGL02301:Zfp423 APN 8 87781574 missense probably damaging 1.00
IGL02320:Zfp423 APN 8 87781602 missense probably damaging 1.00
IGL02804:Zfp423 APN 8 87782657 missense probably benign 0.02
IGL03090:Zfp423 APN 8 87781443 missense probably damaging 1.00
IGL03198:Zfp423 APN 8 87781676 missense possibly damaging 0.73
IGL03383:Zfp423 APN 8 87859452 nonsense probably null
swell UTSW 8 87686559 splice site probably null
R0110:Zfp423 UTSW 8 87782259 missense possibly damaging 0.60
R0142:Zfp423 UTSW 8 87780340 nonsense probably null
R0256:Zfp423 UTSW 8 87773634 nonsense probably null
R0538:Zfp423 UTSW 8 87782085 missense probably damaging 0.99
R0542:Zfp423 UTSW 8 87780609 missense probably damaging 1.00
R0614:Zfp423 UTSW 8 87782114 missense probably damaging 1.00
R1179:Zfp423 UTSW 8 87688072 missense probably damaging 0.97
R1417:Zfp423 UTSW 8 87773656 splice site probably null
R1429:Zfp423 UTSW 8 87686442 missense probably damaging 0.99
R1570:Zfp423 UTSW 8 87782558 missense probably benign 0.37
R2013:Zfp423 UTSW 8 87782397 missense probably benign 0.43
R2043:Zfp423 UTSW 8 87782618 missense probably damaging 1.00
R2064:Zfp423 UTSW 8 87781358 missense probably benign 0.04
R2108:Zfp423 UTSW 8 87781178 missense possibly damaging 0.73
R2358:Zfp423 UTSW 8 87780551 missense possibly damaging 0.56
R3177:Zfp423 UTSW 8 87782331 missense probably damaging 1.00
R3277:Zfp423 UTSW 8 87782331 missense probably damaging 1.00
R3738:Zfp423 UTSW 8 87781344 missense probably damaging 1.00
R3739:Zfp423 UTSW 8 87781344 missense probably damaging 1.00
R3773:Zfp423 UTSW 8 87780512 missense probably benign 0.03
R4034:Zfp423 UTSW 8 87781344 missense probably damaging 1.00
R4425:Zfp423 UTSW 8 87782973 missense probably damaging 1.00
R4611:Zfp423 UTSW 8 87688081 missense possibly damaging 0.90
R4700:Zfp423 UTSW 8 87781710 unclassified probably null
R4753:Zfp423 UTSW 8 87781446 missense probably benign 0.00
R4818:Zfp423 UTSW 8 87904500 missense probably benign 0.00
R5026:Zfp423 UTSW 8 87780674 missense probably damaging 1.00
R5190:Zfp423 UTSW 8 87782463 missense probably damaging 1.00
R5243:Zfp423 UTSW 8 87773647 missense probably benign 0.03
R5284:Zfp423 UTSW 8 87781677 missense possibly damaging 0.73
R5601:Zfp423 UTSW 8 87782009 missense probably damaging 1.00
R5671:Zfp423 UTSW 8 87782327 missense probably damaging 0.99
R5717:Zfp423 UTSW 8 87686559 splice site probably null
R5801:Zfp423 UTSW 8 87859362 missense probably damaging 0.99
R5917:Zfp423 UTSW 8 87782232 nonsense probably null
R5985:Zfp423 UTSW 8 87782146 missense possibly damaging 0.83
R6111:Zfp423 UTSW 8 87782687 missense probably damaging 0.99
R6306:Zfp423 UTSW 8 87782034 missense possibly damaging 0.64
R6770:Zfp423 UTSW 8 87781817 missense probably damaging 0.99
R6970:Zfp423 UTSW 8 87803779 missense probably benign 0.00
R7029:Zfp423 UTSW 8 87688066 missense probably damaging 0.99
R7060:Zfp423 UTSW 8 87782879 missense probably damaging 1.00
R7074:Zfp423 UTSW 8 87782432 missense probably benign 0.00
R7121:Zfp423 UTSW 8 87780861 missense probably damaging 1.00
R7242:Zfp423 UTSW 8 87904527 missense probably benign 0.07
R7359:Zfp423 UTSW 8 87782243 missense possibly damaging 0.52
R7426:Zfp423 UTSW 8 87780713 missense probably damaging 1.00
R7540:Zfp423 UTSW 8 87688067 missense possibly damaging 0.95
R7640:Zfp423 UTSW 8 87781277 missense probably damaging 1.00
R7767:Zfp423 UTSW 8 87780884 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTAATTTCTGCCTGCCAGG -3'
(R):5'- TTAAAACCCCTTTCCTGAGACC -3'

Sequencing Primer
(F):5'- TGCCTGCCAGGAAGCTGTG -3'
(R):5'- TTTCCTGAGACCCCGTCGG -3'
Posted On2016-10-26