Incidental Mutation 'R5586:Tet1'
ID 438729
Institutional Source Beutler Lab
Gene Symbol Tet1
Ensembl Gene ENSMUSG00000047146
Gene Name tet methylcytosine dioxygenase 1
Synonyms Cxxc6, D10Ertd17e, 2510010B09Rik, BB001228
MMRRC Submission 043140-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5586 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 62640349-62723242 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 62714073 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 574 (C574F)
Ref Sequence ENSEMBL: ENSMUSP00000059527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050826] [ENSMUST00000174189] [ENSMUST00000218438] [ENSMUST00000218782] [ENSMUST00000227494] [ENSMUST00000228901]
AlphaFold Q3URK3
Predicted Effect probably damaging
Transcript: ENSMUST00000050826
AA Change: C574F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059527
Gene: ENSMUSG00000047146
AA Change: C574F

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
Pfam:zf-CXXC 566 607 2.5e-11 PFAM
low complexity region 884 902 N/A INTRINSIC
low complexity region 1087 1106 N/A INTRINSIC
Tet_JBP 1528 1931 1e-171 SMART
low complexity region 1944 1956 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174189
AA Change: C574F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133279
Gene: ENSMUSG00000047146
AA Change: C574F

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
Pfam:zf-CXXC 566 607 2.7e-10 PFAM
low complexity region 884 902 N/A INTRINSIC
low complexity region 1087 1106 N/A INTRINSIC
Tet_JBP 1528 1963 7.36e-170 SMART
low complexity region 1976 1988 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218438
Predicted Effect probably benign
Transcript: ENSMUST00000218782
Predicted Effect probably benign
Transcript: ENSMUST00000227494
Predicted Effect probably benign
Transcript: ENSMUST00000228901
Meta Mutation Damage Score 0.7575 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA methylation is an epigenetic mechanism that is important for controlling gene expression. The protein encoded by this gene is a demethylase that belongs to the TET (ten-eleven translocation) family. Members of the TET protein family play a role in the DNA methylation process and gene activation. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit background sensitive lethality, abnormal forebrain development, abnormal female reproductive organs and decreased litter size. Mice homozygous for a different knock-out allele exhibit impaired adult neurogenesis, impaired spatial learning and impaired short-term memory retention. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,277,153 (GRCm39) noncoding transcript Het
Aaas A T 15: 102,255,111 (GRCm39) probably null Het
Abcc3 G A 11: 94,255,247 (GRCm39) R600W probably damaging Het
Abhd13 A T 8: 10,038,318 (GRCm39) Q305L probably benign Het
Adcy5 A T 16: 34,977,486 (GRCm39) I340F probably damaging Het
Adgrl3 T A 5: 81,871,994 (GRCm39) I964N probably damaging Het
Anks1b T A 10: 89,912,926 (GRCm39) H316Q probably damaging Het
Ap3d1 A T 10: 80,554,964 (GRCm39) F454I possibly damaging Het
Apol7c T C 15: 77,410,599 (GRCm39) R116G possibly damaging Het
Arhgap5 A G 12: 52,566,695 (GRCm39) E1222G possibly damaging Het
AW551984 A G 9: 39,502,559 (GRCm39) V673A probably benign Het
Baiap2l1 A G 5: 144,218,949 (GRCm39) S220P probably damaging Het
Bcl6 A G 16: 23,791,926 (GRCm39) F143L probably benign Het
Calb1 A T 4: 15,900,811 (GRCm39) T165S probably benign Het
Ccdc66 C A 14: 27,228,668 (GRCm39) G6C probably damaging Het
Ccdc88a A G 11: 29,453,484 (GRCm39) I344V probably benign Het
Cdh19 T A 1: 110,857,587 (GRCm39) D249V probably damaging Het
Ces1c T A 8: 93,854,227 (GRCm39) T103S probably benign Het
Cfap54 T A 10: 92,808,473 (GRCm39) K1401* probably null Het
Copa T A 1: 171,932,789 (GRCm39) N371K probably damaging Het
Cyp2b10 A T 7: 25,616,437 (GRCm39) Y348F probably damaging Het
Dennd5a T C 7: 109,504,928 (GRCm39) R861G possibly damaging Het
Dhx8 T C 11: 101,623,862 (GRCm39) probably benign Het
Dido1 C T 2: 180,301,445 (GRCm39) W2153* probably null Het
Dlgap1 T A 17: 71,125,156 (GRCm39) V969D probably damaging Het
Dvl3 A G 16: 20,336,039 (GRCm39) D32G probably damaging Het
Epdr1 T C 13: 19,778,718 (GRCm39) D24G probably benign Het
Etnk2 T A 1: 133,307,043 (GRCm39) probably null Het
Fhad1 C T 4: 141,632,442 (GRCm39) M1232I probably benign Het
Gcnt2 A C 13: 41,014,429 (GRCm39) E200A probably damaging Het
Gm5174 A G 10: 86,492,409 (GRCm39) noncoding transcript Het
Gm6408 T A 5: 146,421,267 (GRCm39) F299I possibly damaging Het
Gpr85 G T 6: 13,836,000 (GRCm39) Y301* probably null Het
Gucy2e G T 11: 69,117,082 (GRCm39) P780T probably damaging Het
Icam5 A T 9: 20,946,116 (GRCm39) N316I probably damaging Het
Ifit1bl1 C T 19: 34,571,677 (GRCm39) R260Q probably damaging Het
Il1r1 A C 1: 40,264,411 (GRCm39) probably benign Het
Kif3c A T 12: 3,439,656 (GRCm39) I86F probably benign Het
Klhdc2 A G 12: 69,354,467 (GRCm39) probably null Het
Mast2 A G 4: 116,292,760 (GRCm39) L9P probably damaging Het
Mcoln1 G T 8: 3,560,389 (GRCm39) C316F probably damaging Het
Mon1a A T 9: 107,775,894 (GRCm39) D4V probably damaging Het
Ms4a18 T A 19: 10,991,038 (GRCm39) M19L probably benign Het
Nbea T C 3: 55,539,392 (GRCm39) K2790E probably benign Het
Niban1 C T 1: 151,593,307 (GRCm39) T664I probably benign Het
Noc3l C T 19: 38,803,139 (GRCm39) E167K possibly damaging Het
Nol10 G A 12: 17,466,829 (GRCm39) E570K possibly damaging Het
Nr2e3 T C 9: 59,856,484 (GRCm39) R69G probably damaging Het
Obscn G A 11: 58,892,294 (GRCm39) R1358* probably null Het
Or14j4 A T 17: 37,921,145 (GRCm39) F166I probably damaging Het
Or2b7 C A 13: 21,739,266 (GRCm39) V309F probably damaging Het
Or52e8b A G 7: 104,673,428 (GRCm39) I253T probably damaging Het
Or5b117 A T 19: 13,431,746 (GRCm39) M45K probably benign Het
Pak2 A T 16: 31,860,337 (GRCm39) D175E probably benign Het
Pccb C T 9: 100,867,856 (GRCm39) V357I possibly damaging Het
Pcdhb4 C T 18: 37,442,034 (GRCm39) P448L probably damaging Het
Pcdhb9 A G 18: 37,534,167 (GRCm39) M54V probably benign Het
Ppp3cb A G 14: 20,570,758 (GRCm39) probably benign Het
Ppp4r1 A G 17: 66,131,563 (GRCm39) D452G probably benign Het
Pramel18 T A 4: 101,767,317 (GRCm39) F189I probably benign Het
Prmt3 T A 7: 49,476,499 (GRCm39) D369E probably damaging Het
Psmd12 T A 11: 107,377,301 (GRCm39) V120D probably benign Het
Ptprb T C 10: 116,189,732 (GRCm39) L1797P probably damaging Het
Ptprm A G 17: 67,227,191 (GRCm39) S653P probably damaging Het
Pxdn T A 12: 30,053,141 (GRCm39) V926D probably damaging Het
Retreg3 T G 11: 100,997,165 (GRCm39) Q105P probably damaging Het
Sacs A T 14: 61,443,890 (GRCm39) R1979* probably null Het
Scn2a T A 2: 65,537,639 (GRCm39) L696* probably null Het
Sema3c A T 5: 17,916,422 (GRCm39) N465Y probably damaging Het
Slc25a32 A T 15: 38,963,308 (GRCm39) V171E possibly damaging Het
Slc30a7 C T 3: 115,783,700 (GRCm39) V158I probably benign Het
Slc44a5 G A 3: 153,975,802 (GRCm39) probably benign Het
Slc4a8 A G 15: 100,685,045 (GRCm39) D140G probably damaging Het
Slc7a11 G A 3: 50,397,532 (GRCm39) S60L possibly damaging Het
Spryd3 A T 15: 102,040,372 (GRCm39) H59Q probably benign Het
Sqstm1 T C 11: 50,093,849 (GRCm39) D256G probably damaging Het
Sst A T 16: 23,708,487 (GRCm39) S115T probably damaging Het
Stimate A G 14: 30,592,776 (GRCm39) K166E probably damaging Het
Surf1 T C 2: 26,805,963 (GRCm39) probably benign Het
Synj1 A T 16: 90,806,865 (GRCm39) probably benign Het
Thnsl1 T A 2: 21,217,201 (GRCm39) Y318* probably null Het
Tomm70a A G 16: 56,942,493 (GRCm39) E90G probably damaging Het
Treml4 A G 17: 48,571,927 (GRCm39) D110G probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Txnl1 C T 18: 63,797,396 (GRCm39) G283D probably damaging Het
Uba6 T C 5: 86,282,906 (GRCm39) D559G probably damaging Het
Usp4 T C 9: 108,233,661 (GRCm39) V94A possibly damaging Het
Vmn2r25 A C 6: 123,802,255 (GRCm39) C549W probably damaging Het
Vmn2r59 G T 7: 41,695,105 (GRCm39) Q436K probably benign Het
Wdr70 A T 15: 7,913,769 (GRCm39) Y627N possibly damaging Het
Xpr1 T C 1: 155,188,609 (GRCm39) I344V probably benign Het
Zfp423 T A 8: 88,585,968 (GRCm39) Q61L possibly damaging Het
Other mutations in Tet1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Tet1 APN 10 62,650,276 (GRCm39) missense probably damaging 1.00
IGL01079:Tet1 APN 10 62,715,252 (GRCm39) missense probably damaging 0.99
IGL01109:Tet1 APN 10 62,715,553 (GRCm39) missense probably benign
IGL01634:Tet1 APN 10 62,714,367 (GRCm39) missense possibly damaging 0.94
IGL02003:Tet1 APN 10 62,652,179 (GRCm39) missense possibly damaging 0.92
IGL02081:Tet1 APN 10 62,649,597 (GRCm39) missense probably damaging 1.00
IGL02100:Tet1 APN 10 62,648,507 (GRCm39) missense possibly damaging 0.92
IGL02228:Tet1 APN 10 62,649,513 (GRCm39) missense probably damaging 0.99
IGL02524:Tet1 APN 10 62,714,425 (GRCm39) missense probably damaging 1.00
IGL02539:Tet1 APN 10 62,648,798 (GRCm39) missense possibly damaging 0.60
IGL02608:Tet1 APN 10 62,674,866 (GRCm39) missense probably damaging 1.00
IGL02608:Tet1 APN 10 62,715,388 (GRCm39) missense possibly damaging 0.82
IGL02702:Tet1 APN 10 62,715,531 (GRCm39) missense possibly damaging 0.83
K7371:Tet1 UTSW 10 62,714,955 (GRCm39) missense probably benign
R0166:Tet1 UTSW 10 62,676,058 (GRCm39) missense probably benign 0.05
R0371:Tet1 UTSW 10 62,714,178 (GRCm39) missense probably damaging 0.97
R0373:Tet1 UTSW 10 62,713,988 (GRCm39) nonsense probably null
R0391:Tet1 UTSW 10 62,650,325 (GRCm39) splice site probably null
R0445:Tet1 UTSW 10 62,715,720 (GRCm39) missense probably benign 0.08
R1016:Tet1 UTSW 10 62,715,729 (GRCm39) missense probably benign
R1344:Tet1 UTSW 10 62,650,300 (GRCm39) missense probably damaging 1.00
R1546:Tet1 UTSW 10 62,648,689 (GRCm39) missense probably damaging 1.00
R1651:Tet1 UTSW 10 62,715,453 (GRCm39) missense probably damaging 1.00
R1725:Tet1 UTSW 10 62,650,256 (GRCm39) missense probably damaging 1.00
R1752:Tet1 UTSW 10 62,648,768 (GRCm39) missense probably damaging 0.99
R1834:Tet1 UTSW 10 62,649,444 (GRCm39) missense probably damaging 0.99
R1964:Tet1 UTSW 10 62,648,726 (GRCm39) missense possibly damaging 0.86
R2239:Tet1 UTSW 10 62,715,513 (GRCm39) missense probably benign 0.01
R2962:Tet1 UTSW 10 62,650,323 (GRCm39) nonsense probably null
R3084:Tet1 UTSW 10 62,715,400 (GRCm39) missense probably benign 0.34
R3086:Tet1 UTSW 10 62,715,400 (GRCm39) missense probably benign 0.34
R3972:Tet1 UTSW 10 62,649,505 (GRCm39) missense probably damaging 1.00
R4622:Tet1 UTSW 10 62,655,253 (GRCm39) missense possibly damaging 0.92
R4674:Tet1 UTSW 10 62,674,627 (GRCm39) missense probably damaging 0.97
R4687:Tet1 UTSW 10 62,674,570 (GRCm39) missense probably benign 0.04
R4718:Tet1 UTSW 10 62,649,591 (GRCm39) missense probably damaging 0.96
R4801:Tet1 UTSW 10 62,658,442 (GRCm39) missense probably damaging 0.99
R4802:Tet1 UTSW 10 62,658,442 (GRCm39) missense probably damaging 0.99
R4903:Tet1 UTSW 10 62,658,437 (GRCm39) missense probably damaging 1.00
R5153:Tet1 UTSW 10 62,714,357 (GRCm39) missense possibly damaging 0.85
R5193:Tet1 UTSW 10 62,674,026 (GRCm39) missense probably benign 0.22
R5225:Tet1 UTSW 10 62,674,450 (GRCm39) missense probably damaging 1.00
R5437:Tet1 UTSW 10 62,650,230 (GRCm39) missense probably benign 0.01
R5465:Tet1 UTSW 10 62,675,556 (GRCm39) missense probably benign
R5535:Tet1 UTSW 10 62,668,686 (GRCm39) missense probably damaging 1.00
R5763:Tet1 UTSW 10 62,675,847 (GRCm39) missense probably damaging 1.00
R5788:Tet1 UTSW 10 62,675,737 (GRCm39) missense possibly damaging 0.70
R5818:Tet1 UTSW 10 62,652,187 (GRCm39) missense possibly damaging 0.71
R5860:Tet1 UTSW 10 62,648,399 (GRCm39) splice site probably null
R5975:Tet1 UTSW 10 62,715,552 (GRCm39) missense probably benign 0.37
R6041:Tet1 UTSW 10 62,649,152 (GRCm39) missense probably damaging 0.98
R6092:Tet1 UTSW 10 62,649,494 (GRCm39) missense probably benign 0.10
R6132:Tet1 UTSW 10 62,649,079 (GRCm39) missense probably damaging 0.99
R6157:Tet1 UTSW 10 62,675,749 (GRCm39) missense probably damaging 0.98
R6520:Tet1 UTSW 10 62,715,792 (GRCm39) start codon destroyed probably null 0.53
R7210:Tet1 UTSW 10 62,650,280 (GRCm39) missense probably null 0.95
R7223:Tet1 UTSW 10 62,649,450 (GRCm39) missense possibly damaging 0.95
R7255:Tet1 UTSW 10 62,658,415 (GRCm39) missense probably benign 0.15
R7323:Tet1 UTSW 10 62,715,818 (GRCm39) start gained probably benign
R7472:Tet1 UTSW 10 62,649,129 (GRCm39) missense possibly damaging 0.84
R7507:Tet1 UTSW 10 62,668,671 (GRCm39) critical splice donor site probably null
R7522:Tet1 UTSW 10 62,654,762 (GRCm39) missense possibly damaging 0.82
R7849:Tet1 UTSW 10 62,655,252 (GRCm39) missense possibly damaging 0.83
R7879:Tet1 UTSW 10 62,714,825 (GRCm39) missense probably benign 0.03
R8073:Tet1 UTSW 10 62,649,132 (GRCm39) missense probably damaging 0.98
R8098:Tet1 UTSW 10 62,714,859 (GRCm39) missense probably damaging 1.00
R8147:Tet1 UTSW 10 62,714,586 (GRCm39) missense probably benign 0.01
R8355:Tet1 UTSW 10 62,652,229 (GRCm39) missense possibly damaging 0.89
R8545:Tet1 UTSW 10 62,648,718 (GRCm39) missense probably damaging 1.00
R8556:Tet1 UTSW 10 62,675,985 (GRCm39) missense probably benign 0.37
R8936:Tet1 UTSW 10 62,676,063 (GRCm39) nonsense probably null
R9173:Tet1 UTSW 10 62,676,065 (GRCm39) missense probably benign
R9414:Tet1 UTSW 10 62,674,935 (GRCm39) missense probably benign 0.01
R9584:Tet1 UTSW 10 62,655,306 (GRCm39) missense probably damaging 1.00
Z1177:Tet1 UTSW 10 62,654,764 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TCCACAAATTCTTAGGGGCGG -3'
(R):5'- AGATCTTACCCAGGGTTCTCAGG -3'

Sequencing Primer
(F):5'- GACTGATGCTGCGCCAAAC -3'
(R):5'- AGGGTTCTCAGGCTGCTC -3'
Posted On 2016-10-26