Mutagenetix > Incidental Mutation

Incidental Mutation 'R5586:Cfap54'

438734

Institutional Source

Beutler Lab

Gene Symbol

Cfap54

Ensembl Gene

ENSMUSG00000020014

Gene Name

cilia and flagella associated protein 54

Synonyms

LOC380653, Gm872, 4930485B16Rik

MMRRC Submission

043140-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R5586 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92775619-93081618 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 92972611 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 1401 (K1401*)

Ref Sequence

ENSEMBL: ENSMUSP00000148636 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168110] [ENSMUST00000170065] [ENSMUST00000212902]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000168110
AA Change: K1401*

SMART Domains

Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: K1401*

Domain	Start	End	E-Value	Type
low complexity region	3	37	N/A	INTRINSIC
low complexity region	39	48	N/A	INTRINSIC
Pfam:DUF4486	104	642	1.1e-269	PFAM
low complexity region	842	851	N/A	INTRINSIC
low complexity region	902	915	N/A	INTRINSIC
Blast:FN3	916	1002	4e-48	BLAST
low complexity region	1409	1426	N/A	INTRINSIC
low complexity region	1974	1984	N/A	INTRINSIC
low complexity region	2354	2370	N/A	INTRINSIC
low complexity region	2500	2513	N/A	INTRINSIC
low complexity region	2605	2616	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170065

Predicted Effect

probably null
Transcript: ENSMUST00000212902
AA Change: K1401*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.0%

Validation Efficiency

98% (101/103)

MGI Phenotype

PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	G	7: 29,577,728		noncoding transcript	Het
Aaas	A	T	15: 102,346,676		probably null	Het
Abcc3	G	A	11: 94,364,421	R600W	probably damaging	Het
Abhd13	A	T	8: 9,988,318	Q305L	probably benign	Het
Adcy5	A	T	16: 35,157,116	I340F	probably damaging	Het
Adgrl3	T	A	5: 81,724,147	I964N	probably damaging	Het
Anks1b	T	A	10: 90,077,064	H316Q	probably damaging	Het
Ap3d1	A	T	10: 80,719,130	F454I	possibly damaging	Het
Apol7c	T	C	15: 77,526,399	R116G	possibly damaging	Het
Arhgap5	A	G	12: 52,519,912	E1222G	possibly damaging	Het
AW551984	A	G	9: 39,591,263	V673A	probably benign	Het
Baiap2l1	A	G	5: 144,282,139	S220P	probably damaging	Het
Bcl6	A	G	16: 23,973,176	F143L	probably benign	Het
Calb1	A	T	4: 15,900,811	T165S	probably benign	Het
Ccdc66	C	A	14: 27,506,711	G6C	probably damaging	Het
Ccdc88a	A	G	11: 29,503,484	I344V	probably benign	Het
Cdh19	T	A	1: 110,929,857	D249V	probably damaging	Het
Ces1c	T	A	8: 93,127,599	T103S	probably benign	Het
Copa	T	A	1: 172,105,222	N371K	probably damaging	Het
Cyp2b10	A	T	7: 25,917,012	Y348F	probably damaging	Het
Dennd5a	T	C	7: 109,905,721	R861G	possibly damaging	Het
Dhx8	T	C	11: 101,733,036		probably benign	Het
Dido1	C	T	2: 180,659,652	W2153*	probably null	Het
Dlgap1	T	A	17: 70,818,161	V969D	probably damaging	Het
Dvl3	A	G	16: 20,517,289	D32G	probably damaging	Het
Epdr1	T	C	13: 19,594,548	D24G	probably benign	Het
Etnk2	T	A	1: 133,379,305		probably null	Het
Fam129a	C	T	1: 151,717,556	T664I	probably benign	Het
Fhad1	C	T	4: 141,905,131	M1232I	probably benign	Het
Gcnt2	A	C	13: 40,860,953	E200A	probably damaging	Het
Gm12800	T	A	4: 101,910,120	F189I	probably benign	Het
Gm5174	A	G	10: 86,656,545		noncoding transcript	Het
Gm6408	T	A	5: 146,484,457	F299I	possibly damaging	Het
Gpr85	G	T	6: 13,836,001	Y301*	probably null	Het
Gucy2e	G	T	11: 69,226,256	P780T	probably damaging	Het
Icam5	A	T	9: 21,034,820	N316I	probably damaging	Het
Ifit1bl1	C	T	19: 34,594,277	R260Q	probably damaging	Het
Il1r1	A	C	1: 40,225,251		probably benign	Het
Kif3c	A	T	12: 3,389,656	I86F	probably benign	Het
Klhdc2	A	G	12: 69,307,693		probably null	Het
Mast2	A	G	4: 116,435,563	L9P	probably damaging	Het
Mcoln1	G	T	8: 3,510,389	C316F	probably damaging	Het
Mon1a	A	T	9: 107,898,695	D4V	probably damaging	Het
Ms4a18	T	A	19: 11,013,674	M19L	probably benign	Het
Nbea	T	C	3: 55,631,971	K2790E	probably benign	Het
Noc3l	C	T	19: 38,814,695	E167K	possibly damaging	Het
Nol10	G	A	12: 17,416,828	E570K	possibly damaging	Het
Nr2e3	T	C	9: 59,949,201	R69G	probably damaging	Het
Obscn	G	A	11: 59,001,468	R1358*	probably null	Het
Olfr115	A	T	17: 37,610,254	F166I	probably damaging	Het
Olfr1472	A	T	19: 13,454,382	M45K	probably benign	Het
Olfr1535	C	A	13: 21,555,096	V309F	probably damaging	Het
Olfr675	A	G	7: 105,024,221	I253T	probably damaging	Het
Pak2	A	T	16: 32,041,519	D175E	probably benign	Het
Pccb	C	T	9: 100,985,803	V357I	possibly damaging	Het
Pcdhb4	C	T	18: 37,308,981	P448L	probably damaging	Het
Pcdhb9	A	G	18: 37,401,114	M54V	probably benign	Het
Ppp3cb	A	G	14: 20,520,690		probably benign	Het
Ppp4r1	A	G	17: 65,824,568	D452G	probably benign	Het
Prmt3	T	A	7: 49,826,751	D369E	probably damaging	Het
Psmd12	T	A	11: 107,486,475	V120D	probably benign	Het
Ptprb	T	C	10: 116,353,827	L1797P	probably damaging	Het
Ptprm	A	G	17: 66,920,196	S653P	probably damaging	Het
Pxdn	T	A	12: 30,003,142	V926D	probably damaging	Het
Retreg3	T	G	11: 101,106,339	Q105P	probably damaging	Het
Sacs	A	T	14: 61,206,441	R1979*	probably null	Het
Scn2a	T	A	2: 65,707,295	L696*	probably null	Het
Sema3c	A	T	5: 17,711,424	N465Y	probably damaging	Het
Slc25a32	A	T	15: 39,099,913	V171E	possibly damaging	Het
Slc30a7	C	T	3: 115,990,051	V158I	probably benign	Het
Slc44a5	G	A	3: 154,270,165		probably benign	Het
Slc4a8	A	G	15: 100,787,164	D140G	probably damaging	Het
Slc7a11	G	A	3: 50,443,083	S60L	possibly damaging	Het
Spryd3	A	T	15: 102,131,937	H59Q	probably benign	Het
Sqstm1	T	C	11: 50,203,022	D256G	probably damaging	Het
Sst	A	T	16: 23,889,737	S115T	probably damaging	Het
Surf1	T	C	2: 26,915,951		probably benign	Het
Synj1	A	T	16: 91,009,977		probably benign	Het
Tet1	C	A	10: 62,878,294	C574F	probably damaging	Het
Thnsl1	T	A	2: 21,212,390	Y318*	probably null	Het
Tmem110	A	G	14: 30,870,819	K166E	probably damaging	Het
Tomm70a	A	G	16: 57,122,130	E90G	probably damaging	Het
Treml4	A	G	17: 48,264,899	D110G	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Txnl1	C	T	18: 63,664,325	G283D	probably damaging	Het
Uba6	T	C	5: 86,135,047	D559G	probably damaging	Het
Usp4	T	C	9: 108,356,462	V94A	possibly damaging	Het
Vmn2r25	A	C	6: 123,825,296	C549W	probably damaging	Het
Vmn2r59	G	T	7: 42,045,681	Q436K	probably benign	Het
Wdr70	A	T	15: 7,884,288	Y627N	possibly damaging	Het
Xpr1	T	C	1: 155,312,863	I344V	probably benign	Het
Zfp423	T	A	8: 87,859,340	Q61L	possibly damaging	Het

Other mutations in Cfap54

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cfap54	APN	10	93081523	missense	unknown
IGL02034:Cfap54	APN	10	93061485	missense	probably damaging	0.99
IGL02082:Cfap54	APN	10	93081458	missense	unknown
IGL02434:Cfap54	APN	10	93066754	missense	probably benign	0.20
R0011:Cfap54	UTSW	10	93065225	missense	probably damaging	0.97
R0011:Cfap54	UTSW	10	93065225	missense	probably damaging	0.97
R0032:Cfap54	UTSW	10	92932697	missense	probably benign	0.04
R0032:Cfap54	UTSW	10	92932697	missense	probably benign	0.04
R0040:Cfap54	UTSW	10	92977039	missense	probably benign	0.33
R0044:Cfap54	UTSW	10	93035433	missense	probably null	0.46
R0086:Cfap54	UTSW	10	93028594	missense	possibly damaging	0.86
R0104:Cfap54	UTSW	10	93028652	missense	probably damaging	1.00
R0194:Cfap54	UTSW	10	93034662	unclassified	probably benign
R0234:Cfap54	UTSW	10	92899160	nonsense	probably null
R0308:Cfap54	UTSW	10	92885364	missense	unknown
R0332:Cfap54	UTSW	10	93035457	missense	probably damaging	1.00
R0409:Cfap54	UTSW	10	92776213	missense	probably benign	0.00
R0433:Cfap54	UTSW	10	92979080	splice site	probably benign
R0436:Cfap54	UTSW	10	93038975	missense	possibly damaging	0.95
R0463:Cfap54	UTSW	10	92874943	critical splice donor site	probably null
R0523:Cfap54	UTSW	10	92908883	utr 3 prime	probably benign
R0551:Cfap54	UTSW	10	93025122	missense	probably benign	0.35
R0595:Cfap54	UTSW	10	92884736	missense	unknown
R0617:Cfap54	UTSW	10	92829650	splice site	probably benign
R0632:Cfap54	UTSW	10	92885096	missense	unknown
R0730:Cfap54	UTSW	10	93034737	missense	probably benign	0.05
R0786:Cfap54	UTSW	10	92967535	missense	possibly damaging	0.72
R0883:Cfap54	UTSW	10	92870669	missense	unknown
R1004:Cfap54	UTSW	10	93066696	splice site	probably benign
R1033:Cfap54	UTSW	10	92839449	missense	probably benign	0.07
R1168:Cfap54	UTSW	10	92937920	missense	probably damaging	0.99
R1186:Cfap54	UTSW	10	92875994	missense	unknown
R1429:Cfap54	UTSW	10	92821038	missense	probably benign	0.01
R1443:Cfap54	UTSW	10	92932721	missense	probably damaging	1.00
R1467:Cfap54	UTSW	10	92969763	missense	probably benign	0.01
R1557:Cfap54	UTSW	10	92984227	missense	possibly damaging	0.68
R1687:Cfap54	UTSW	10	92932640	missense	probably damaging	1.00
R1690:Cfap54	UTSW	10	93035442	missense	possibly damaging	0.95
R1711:Cfap54	UTSW	10	93011020	missense	probably damaging	1.00
R1756:Cfap54	UTSW	10	93048061	missense	probably damaging	1.00
R1769:Cfap54	UTSW	10	92904263	critical splice donor site	probably null
R1835:Cfap54	UTSW	10	92962375	missense	probably benign	0.35
R1889:Cfap54	UTSW	10	93034710	missense	possibly damaging	0.94
R1915:Cfap54	UTSW	10	92884702	missense	unknown
R1958:Cfap54	UTSW	10	92997342	missense	probably benign	0.18
R2005:Cfap54	UTSW	10	92884768	missense	unknown
R2018:Cfap54	UTSW	10	93016604	missense	probably benign	0.00
R2045:Cfap54	UTSW	10	93038809	splice site	probably null
R2059:Cfap54	UTSW	10	92942979	unclassified	probably benign
R2100:Cfap54	UTSW	10	93001937	missense	possibly damaging	0.84
R2110:Cfap54	UTSW	10	92886367	missense	unknown
R2392:Cfap54	UTSW	10	93025011	critical splice donor site	probably null
R2508:Cfap54	UTSW	10	92997374	missense	possibly damaging	0.72
R2852:Cfap54	UTSW	10	92940155	missense	probably damaging	1.00
R2857:Cfap54	UTSW	10	93045282	missense	probably damaging	0.99
R2871:Cfap54	UTSW	10	92921419	missense	possibly damaging	0.86
R2871:Cfap54	UTSW	10	92921419	missense	possibly damaging	0.86
R3107:Cfap54	UTSW	10	92994683	missense	probably benign	0.04
R3108:Cfap54	UTSW	10	92994683	missense	probably benign	0.04
R3157:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3158:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3159:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3161:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3162:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3162:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3508:Cfap54	UTSW	10	92885424	missense	unknown
R3730:Cfap54	UTSW	10	93011473	nonsense	probably null
R3770:Cfap54	UTSW	10	92878536	missense	unknown
R3776:Cfap54	UTSW	10	93045100	missense	probably damaging	1.00
R3778:Cfap54	UTSW	10	92904344	utr 3 prime	probably benign
R3795:Cfap54	UTSW	10	92942873	unclassified	probably benign
R3834:Cfap54	UTSW	10	92801123	splice site	probably benign
R3891:Cfap54	UTSW	10	93038846	missense	possibly damaging	0.87
R3932:Cfap54	UTSW	10	92829757	missense	probably benign	0.03
R3973:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3974:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3976:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3978:Cfap54	UTSW	10	92962412	missense	probably benign	0.01
R4190:Cfap54	UTSW	10	92885023	missense	unknown
R4389:Cfap54	UTSW	10	92967500	missense	probably benign	0.37
R4542:Cfap54	UTSW	10	93025129	missense	probably benign	0.12
R4564:Cfap54	UTSW	10	92839540	unclassified	probably benign
R4576:Cfap54	UTSW	10	93043228	critical splice donor site	probably null
R4620:Cfap54	UTSW	10	92969757	missense	probably benign	0.01
R4714:Cfap54	UTSW	10	92815918	missense	probably benign	0.01
R4762:Cfap54	UTSW	10	93061453	splice site	probably null
R4776:Cfap54	UTSW	10	92972694	missense	possibly damaging	0.96
R4819:Cfap54	UTSW	10	92836477	nonsense	probably null
R4827:Cfap54	UTSW	10	92902075	utr 3 prime	probably benign
R4832:Cfap54	UTSW	10	92967528	missense	probably benign	0.01
R4965:Cfap54	UTSW	10	93066799	missense	probably benign	0.23
R5001:Cfap54	UTSW	10	92964534	missense	probably benign	0.01
R5060:Cfap54	UTSW	10	93039151	missense	probably damaging	1.00
R5067:Cfap54	UTSW	10	93066766	missense	probably benign	0.17
R5069:Cfap54	UTSW	10	92937774	missense	probably benign
R5094:Cfap54	UTSW	10	92898999	utr 3 prime	probably benign
R5109:Cfap54	UTSW	10	92937891	missense	probably benign	0.03
R5127:Cfap54	UTSW	10	92886387	splice site	probably null
R5143:Cfap54	UTSW	10	93029158	missense	possibly damaging	0.73
R5147:Cfap54	UTSW	10	92937838	missense	probably benign	0.00
R5158:Cfap54	UTSW	10	93065197	missense	probably damaging	1.00
R5256:Cfap54	UTSW	10	92935091	nonsense	probably null
R5256:Cfap54	UTSW	10	93045023	splice site	probably null
R5266:Cfap54	UTSW	10	92815902	missense	probably benign	0.16
R5304:Cfap54	UTSW	10	92821106	missense	probably damaging	0.97
R5369:Cfap54	UTSW	10	93061257	intron	probably benign
R5406:Cfap54	UTSW	10	93001858	missense	probably benign	0.33
R5471:Cfap54	UTSW	10	93028660	missense	probably damaging	1.00
R5485:Cfap54	UTSW	10	93029117	missense	probably damaging	1.00
R5540:Cfap54	UTSW	10	92972608	missense	possibly damaging	0.85
R5614:Cfap54	UTSW	10	93045049	missense	probably damaging	1.00
R5634:Cfap54	UTSW	10	92904263	critical splice donor site	probably benign
R5680:Cfap54	UTSW	10	92979017	nonsense	probably null
R5797:Cfap54	UTSW	10	92967576	missense	probably benign	0.11
R5859:Cfap54	UTSW	10	93016524	nonsense	probably null
R5878:Cfap54	UTSW	10	92964561	missense	probably benign	0.01
R5910:Cfap54	UTSW	10	93065181	missense	probably damaging	0.99
R5936:Cfap54	UTSW	10	92962412	missense	probably benign	0.01
R5994:Cfap54	UTSW	10	93039081	missense	probably damaging	0.99
R6080:Cfap54	UTSW	10	93045335	missense	possibly damaging	0.64
R6268:Cfap54	UTSW	10	93038909	missense	probably damaging	1.00
R6296:Cfap54	UTSW	10	93066846	missense	probably damaging	1.00
R6409:Cfap54	UTSW	10	92967492	missense	probably benign	0.04
R6545:Cfap54	UTSW	10	92836457	missense	probably benign	0.31
R6570:Cfap54	UTSW	10	92815958	missense	unknown
R6597:Cfap54	UTSW	10	92999040	missense	possibly damaging	0.85
R6702:Cfap54	UTSW	10	92868734	missense	unknown
R6703:Cfap54	UTSW	10	92868734	missense	unknown
R6720:Cfap54	UTSW	10	92821119	missense	probably benign	0.07
R6841:Cfap54	UTSW	10	92875015	missense	unknown
R6910:Cfap54	UTSW	10	92836512	missense	probably benign	0.29
R6953:Cfap54	UTSW	10	92994678	missense	probably benign	0.19
R7009:Cfap54	UTSW	10	92875019	missense	unknown
R7129:Cfap54	UTSW	10	93016571	missense	probably benign	0.06
R7131:Cfap54	UTSW	10	92821104	missense	probably benign	0.03
R7171:Cfap54	UTSW	10	92776210	missense	probably damaging	0.99
R7189:Cfap54	UTSW	10	92937728	missense	unknown
R7225:Cfap54	UTSW	10	92904374	missense	unknown
R7270:Cfap54	UTSW	10	92839458	missense	probably benign	0.03
R7323:Cfap54	UTSW	10	92801138	missense	probably benign	0.00
R7380:Cfap54	UTSW	10	93047978	missense	probably damaging	1.00
R7395:Cfap54	UTSW	10	92884703	missense	unknown
R7411:Cfap54	UTSW	10	92868755	missense	unknown
R7503:Cfap54	UTSW	10	92887436	splice site	probably null
R7622:Cfap54	UTSW	10	92956944	missense	unknown
R7679:Cfap54	UTSW	10	92967512	missense	probably benign	0.01
R7776:Cfap54	UTSW	10	92868741	missense	unknown
R7844:Cfap54	UTSW	10	92902058	missense	unknown
R7980:Cfap54	UTSW	10	92982060	missense	possibly damaging	0.95
R7988:Cfap54	UTSW	10	92902079	missense	unknown
R8101:Cfap54	UTSW	10	92884796	missense	unknown
R8119:Cfap54	UTSW	10	92868810	missense	unknown
R8134:Cfap54	UTSW	10	92878516	missense	unknown
R8168:Cfap54	UTSW	10	92908877	missense	unknown
R8179:Cfap54	UTSW	10	92997316	missense	possibly damaging	0.68
R8392:Cfap54	UTSW	10	92962417	missense	unknown
R8436:Cfap54	UTSW	10	92964536	missense	unknown
R8505:Cfap54	UTSW	10	92978993	missense	probably benign	0.03
R8671:Cfap54	UTSW	10	92955072	missense	unknown
R8716:Cfap54	UTSW	10	92964632	missense	probably benign	0.00
R8816:Cfap54	UTSW	10	92878592	missense	unknown
R8822:Cfap54	UTSW	10	93039141	missense	probably benign	0.09
R8827:Cfap54	UTSW	10	92938248	missense	unknown
R8920:Cfap54	UTSW	10	92940337	critical splice acceptor site	probably null
R8924:Cfap54	UTSW	10	93001823	missense	probably damaging	0.99
R8954:Cfap54	UTSW	10	93043393	missense	probably damaging	1.00
R8963:Cfap54	UTSW	10	93028700	nonsense	probably null
R9010:Cfap54	UTSW	10	92899059	missense	unknown
R9017:Cfap54	UTSW	10	92816021	missense	probably benign	0.07
R9093:Cfap54	UTSW	10	92815908	missense	probably benign	0.03
R9095:Cfap54	UTSW	10	93011020	missense	probably damaging	1.00
R9142:Cfap54	UTSW	10	92984235	missense	possibly damaging	0.87
R9178:Cfap54	UTSW	10	92994717	missense	probably benign	0.10
R9196:Cfap54	UTSW	10	93037891	missense	probably benign	0.22
R9203:Cfap54	UTSW	10	93045128	missense	probably benign	0.30
R9258:Cfap54	UTSW	10	92935098	missense	unknown
R9275:Cfap54	UTSW	10	93039186	missense	possibly damaging	0.86
R9287:Cfap54	UTSW	10	92969703	missense	possibly damaging	0.50
R9289:Cfap54	UTSW	10	92821074	missense	possibly damaging	0.83
R9310:Cfap54	UTSW	10	92962315	missense	unknown
R9397:Cfap54	UTSW	10	92997285	missense	probably damaging	0.96
R9462:Cfap54	UTSW	10	92902058	missense	unknown
R9697:Cfap54	UTSW	10	92956989	missense	unknown
R9746:Cfap54	UTSW	10	92801219	missense	probably benign	0.03
R9755:Cfap54	UTSW	10	92921368	missense	unknown
X0022:Cfap54	UTSW	10	92878603	missense	unknown
X0022:Cfap54	UTSW	10	92932614	missense	probably damaging	1.00
X0027:Cfap54	UTSW	10	92878538	missense	unknown
X0027:Cfap54	UTSW	10	93001888	missense	possibly damaging	0.86
Z1177:Cfap54	UTSW	10	92979026	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATCTGACTGTGAGAATATCTATGTG -3'
(R):5'- GCAGTTTCAACCACCACAGTG -3'

Sequencing Primer
(F):5'- CAGCCATCTCTAGATATACAATC -3'
(R):5'- ACCACAGTGTTCACTAGAGATTC -3'

Posted On

2016-10-26