Incidental Mutation 'R5586:Ptprb'
ID438735
Institutional Source Beutler Lab
Gene Symbol Ptprb
Ensembl Gene ENSMUSG00000020154
Gene Nameprotein tyrosine phosphatase, receptor type, B
Synonyms3230402H02Rik, VE-PTP
MMRRC Submission 043140-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5586 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location116275523-116389535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116353827 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1797 (L1797P)
Ref Sequence ENSEMBL: ENSMUSP00000151821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092167] [ENSMUST00000218553]
Predicted Effect probably damaging
Transcript: ENSMUST00000092167
AA Change: L1510P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089805
Gene: ENSMUSG00000020154
AA Change: L1510P

DomainStartEndE-ValueType
FN3 22 102 8.23e1 SMART
FN3 111 193 1.73e-5 SMART
FN3 204 281 1.56e-3 SMART
FN3 290 366 6.45e-5 SMART
FN3 378 459 5e-2 SMART
FN3 468 546 1.61e-5 SMART
FN3 555 632 7.18e-3 SMART
FN3 644 724 7.52e-6 SMART
FN3 732 811 2.92e-3 SMART
FN3 820 899 2.76e-4 SMART
FN3 908 987 1.29e-4 SMART
FN3 996 1075 7.7e-3 SMART
FN3 1086 1166 1.21e0 SMART
FN3 1174 1253 5.08e-3 SMART
FN3 1262 1340 1.17e-7 SMART
FN3 1356 1435 2.68e-2 SMART
Blast:FN3 1450 1591 6e-88 BLAST
transmembrane domain 1620 1642 N/A INTRINSIC
Blast:PTPc 1643 1681 3e-11 BLAST
PTPc 1703 1966 1.05e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218553
AA Change: L1797P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and one intracytoplasmic catalytic domain, thus belongs to receptor type PTP. The extracellular region of this PTP is composed of multiple fibronectin type_III repeats, which was shown to interact with neuronal receptor and cell adhesion molecules, such as contactin and tenascin C. This protein was also found to interact with sodium channels, and thus may regulate sodium channels by altering tyrosine phosphorylation status. The functions of the interaction partners of this protein implicate the roles of this PTP in cell adhesion, neurite growth, and neuronal differentiation. Alternate transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E10, impaired vascular maintenace and remodeling, heart defects and abnormal yolk sac vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,577,728 noncoding transcript Het
Aaas A T 15: 102,346,676 probably null Het
Abcc3 G A 11: 94,364,421 R600W probably damaging Het
Abhd13 A T 8: 9,988,318 Q305L probably benign Het
Adcy5 A T 16: 35,157,116 I340F probably damaging Het
Adgrl3 T A 5: 81,724,147 I964N probably damaging Het
Anks1b T A 10: 90,077,064 H316Q probably damaging Het
Ap3d1 A T 10: 80,719,130 F454I possibly damaging Het
Apol7c T C 15: 77,526,399 R116G possibly damaging Het
Arhgap5 A G 12: 52,519,912 E1222G possibly damaging Het
AW551984 A G 9: 39,591,263 V673A probably benign Het
Baiap2l1 A G 5: 144,282,139 S220P probably damaging Het
Bcl6 A G 16: 23,973,176 F143L probably benign Het
Calb1 A T 4: 15,900,811 T165S probably benign Het
Ccdc66 C A 14: 27,506,711 G6C probably damaging Het
Ccdc88a A G 11: 29,503,484 I344V probably benign Het
Cdh19 T A 1: 110,929,857 D249V probably damaging Het
Ces1c T A 8: 93,127,599 T103S probably benign Het
Cfap54 T A 10: 92,972,611 K1401* probably null Het
Copa T A 1: 172,105,222 N371K probably damaging Het
Cyp2b10 A T 7: 25,917,012 Y348F probably damaging Het
Dennd5a T C 7: 109,905,721 R861G possibly damaging Het
Dhx8 T C 11: 101,733,036 probably benign Het
Dido1 C T 2: 180,659,652 W2153* probably null Het
Dlgap1 T A 17: 70,818,161 V969D probably damaging Het
Dvl3 A G 16: 20,517,289 D32G probably damaging Het
Epdr1 T C 13: 19,594,548 D24G probably benign Het
Etnk2 T A 1: 133,379,305 probably null Het
Fam129a C T 1: 151,717,556 T664I probably benign Het
Fhad1 C T 4: 141,905,131 M1232I probably benign Het
Gcnt2 A C 13: 40,860,953 E200A probably damaging Het
Gm12800 T A 4: 101,910,120 F189I probably benign Het
Gm5174 A G 10: 86,656,545 noncoding transcript Het
Gm6408 T A 5: 146,484,457 F299I possibly damaging Het
Gpr85 G T 6: 13,836,001 Y301* probably null Het
Gucy2e G T 11: 69,226,256 P780T probably damaging Het
Icam5 A T 9: 21,034,820 N316I probably damaging Het
Ifit1bl1 C T 19: 34,594,277 R260Q probably damaging Het
Il1r1 A C 1: 40,225,251 probably benign Het
Kif3c A T 12: 3,389,656 I86F probably benign Het
Klhdc2 A G 12: 69,307,693 probably null Het
Mast2 A G 4: 116,435,563 L9P probably damaging Het
Mcoln1 G T 8: 3,510,389 C316F probably damaging Het
Mon1a A T 9: 107,898,695 D4V probably damaging Het
Ms4a18 T A 19: 11,013,674 M19L probably benign Het
Nbea T C 3: 55,631,971 K2790E probably benign Het
Noc3l C T 19: 38,814,695 E167K possibly damaging Het
Nol10 G A 12: 17,416,828 E570K possibly damaging Het
Nr2e3 T C 9: 59,949,201 R69G probably damaging Het
Obscn G A 11: 59,001,468 R1358* probably null Het
Olfr115 A T 17: 37,610,254 F166I probably damaging Het
Olfr1472 A T 19: 13,454,382 M45K probably benign Het
Olfr1535 C A 13: 21,555,096 V309F probably damaging Het
Olfr675 A G 7: 105,024,221 I253T probably damaging Het
Pak2 A T 16: 32,041,519 D175E probably benign Het
Pccb C T 9: 100,985,803 V357I possibly damaging Het
Pcdhb4 C T 18: 37,308,981 P448L probably damaging Het
Pcdhb9 A G 18: 37,401,114 M54V probably benign Het
Ppp3cb A G 14: 20,520,690 probably benign Het
Ppp4r1 A G 17: 65,824,568 D452G probably benign Het
Prmt3 T A 7: 49,826,751 D369E probably damaging Het
Psmd12 T A 11: 107,486,475 V120D probably benign Het
Ptprm A G 17: 66,920,196 S653P probably damaging Het
Pxdn T A 12: 30,003,142 V926D probably damaging Het
Retreg3 T G 11: 101,106,339 Q105P probably damaging Het
Sacs A T 14: 61,206,441 R1979* probably null Het
Scn2a T A 2: 65,707,295 L696* probably null Het
Sema3c A T 5: 17,711,424 N465Y probably damaging Het
Slc25a32 A T 15: 39,099,913 V171E possibly damaging Het
Slc30a7 C T 3: 115,990,051 V158I probably benign Het
Slc44a5 G A 3: 154,270,165 probably benign Het
Slc4a8 A G 15: 100,787,164 D140G probably damaging Het
Slc7a11 G A 3: 50,443,083 S60L possibly damaging Het
Spryd3 A T 15: 102,131,937 H59Q probably benign Het
Sqstm1 T C 11: 50,203,022 D256G probably damaging Het
Sst A T 16: 23,889,737 S115T probably damaging Het
Surf1 T C 2: 26,915,951 probably benign Het
Synj1 A T 16: 91,009,977 probably benign Het
Tet1 C A 10: 62,878,294 C574F probably damaging Het
Thnsl1 T A 2: 21,212,390 Y318* probably null Het
Tmem110 A G 14: 30,870,819 K166E probably damaging Het
Tomm70a A G 16: 57,122,130 E90G probably damaging Het
Treml4 A G 17: 48,264,899 D110G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl1 C T 18: 63,664,325 G283D probably damaging Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Usp4 T C 9: 108,356,462 V94A possibly damaging Het
Vmn2r25 A C 6: 123,825,296 C549W probably damaging Het
Vmn2r59 G T 7: 42,045,681 Q436K probably benign Het
Wdr70 A T 15: 7,884,288 Y627N possibly damaging Het
Xpr1 T C 1: 155,312,863 I344V probably benign Het
Zfp423 T A 8: 87,859,340 Q61L possibly damaging Het
Other mutations in Ptprb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Ptprb APN 10 116362648 missense probably benign 0.15
IGL01354:Ptprb APN 10 116343891 missense probably benign 0.24
IGL01404:Ptprb APN 10 116339436 missense probably benign 0.14
IGL01410:Ptprb APN 10 116302274 missense possibly damaging 0.60
IGL01412:Ptprb APN 10 116343915 missense probably benign 0.27
IGL01731:Ptprb APN 10 116372876 missense probably damaging 1.00
IGL02003:Ptprb APN 10 116367505 missense probably damaging 1.00
IGL02110:Ptprb APN 10 116331203 splice site probably benign
IGL02178:Ptprb APN 10 116322532 missense probably benign 0.00
IGL02304:Ptprb APN 10 116331259 missense probably damaging 1.00
IGL02324:Ptprb APN 10 116319333 missense probably benign 0.03
IGL02388:Ptprb APN 10 116367521 missense probably damaging 1.00
IGL02640:Ptprb APN 10 116338664 missense probably damaging 0.99
IGL02698:Ptprb APN 10 116363280 missense probably benign 0.05
IGL02876:Ptprb APN 10 116348211 splice site probably benign
IGL02879:Ptprb APN 10 116327968 missense probably benign
IGL02982:Ptprb APN 10 116322628 missense probably benign 0.20
IGL03146:Ptprb APN 10 116328127 missense probably benign 0.14
IGL03351:Ptprb APN 10 116339582 missense probably benign 0.03
R0306:Ptprb UTSW 10 116343988 missense probably benign 0.04
R0385:Ptprb UTSW 10 116350178 missense probably benign 0.00
R0600:Ptprb UTSW 10 116368807 missense possibly damaging 0.63
R0613:Ptprb UTSW 10 116302325 missense possibly damaging 0.59
R0613:Ptprb UTSW 10 116302378 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116302125 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116339510 missense probably damaging 1.00
R1331:Ptprb UTSW 10 116367532 missense probably damaging 1.00
R1413:Ptprb UTSW 10 116339679 missense probably damaging 1.00
R1418:Ptprb UTSW 10 116319470 missense probably benign 0.00
R1545:Ptprb UTSW 10 116380869 missense probably damaging 1.00
R1562:Ptprb UTSW 10 116339467 missense probably benign 0.00
R1752:Ptprb UTSW 10 116340990 missense probably benign 0.44
R1837:Ptprb UTSW 10 116341626 missense probably benign 0.00
R1940:Ptprb UTSW 10 116319610 splice site probably benign
R1958:Ptprb UTSW 10 116341536 missense probably benign 0.10
R2029:Ptprb UTSW 10 116347053 missense probably benign 0.37
R2031:Ptprb UTSW 10 116317543 missense probably benign
R2101:Ptprb UTSW 10 116315038 splice site probably benign
R2209:Ptprb UTSW 10 116369357 missense probably damaging 1.00
R3016:Ptprb UTSW 10 116357295 missense possibly damaging 0.64
R3076:Ptprb UTSW 10 116344026 missense probably damaging 0.99
R3821:Ptprb UTSW 10 116350074 missense probably benign 0.11
R3824:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3825:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3841:Ptprb UTSW 10 116346982 missense possibly damaging 0.79
R3953:Ptprb UTSW 10 116341494 missense probably benign 0.00
R4125:Ptprb UTSW 10 116353849 missense probably benign 0.12
R4227:Ptprb UTSW 10 116302225 missense possibly damaging 0.96
R4385:Ptprb UTSW 10 116346867 missense probably benign
R4731:Ptprb UTSW 10 116319333 missense probably benign 0.03
R5009:Ptprb UTSW 10 116348127 missense possibly damaging 0.61
R5104:Ptprb UTSW 10 116322459 missense probably benign 0.17
R5114:Ptprb UTSW 10 116348183 missense possibly damaging 0.59
R5145:Ptprb UTSW 10 116343915 missense probably benign 0.27
R5214:Ptprb UTSW 10 116369324 missense possibly damaging 0.75
R5382:Ptprb UTSW 10 116353871 missense probably damaging 1.00
R5553:Ptprb UTSW 10 116350185 missense probably damaging 1.00
R5585:Ptprb UTSW 10 116380854 missense probably damaging 0.98
R5808:Ptprb UTSW 10 116339487 missense probably benign 0.00
R5875:Ptprb UTSW 10 116348166 missense probably benign 0.00
R6051:Ptprb UTSW 10 116341090 nonsense probably null
R6383:Ptprb UTSW 10 116347007 nonsense probably null
R6511:Ptprb UTSW 10 116346820 missense probably damaging 1.00
R6817:Ptprb UTSW 10 116283677 small deletion probably benign
R6826:Ptprb UTSW 10 116317372 missense probably benign 0.26
R6958:Ptprb UTSW 10 116277248 missense probably benign 0.32
R7103:Ptprb UTSW 10 116338813 missense probably damaging 1.00
R7129:Ptprb UTSW 10 116283677 small deletion probably benign
R7181:Ptprb UTSW 10 116368766 missense probably damaging 1.00
R7215:Ptprb UTSW 10 116338776 missense possibly damaging 0.94
R7289:Ptprb UTSW 10 116328165 missense probably damaging 0.99
R7315:Ptprb UTSW 10 116362379 missense possibly damaging 0.83
R7319:Ptprb UTSW 10 116341404 missense probably benign 0.01
R7381:Ptprb UTSW 10 116341133 missense probably benign
R7412:Ptprb UTSW 10 116341138 missense probably benign
R7483:Ptprb UTSW 10 116283429 missense probably benign 0.01
R7495:Ptprb UTSW 10 116341448 missense probably benign 0.12
R7508:Ptprb UTSW 10 116353991 nonsense probably null
R7571:Ptprb UTSW 10 116339430 missense probably damaging 1.00
X0020:Ptprb UTSW 10 116302180 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AGCATCTTTTGAGATCGCAGG -3'
(R):5'- TCAGCGGTCCATCACAGAATTTC -3'

Sequencing Primer
(F):5'- CGCAGGATCTGTATTATAGGATGACC -3'
(R):5'- CAGAATTTCTGCTGACTGGGATCAC -3'
Posted On2016-10-26