Incidental Mutation 'R5586:Sqstm1'
ID 438738
Institutional Source Beutler Lab
Gene Symbol Sqstm1
Ensembl Gene ENSMUSG00000015837
Gene Name sequestosome 1
Synonyms STAP, OSF-6, p62, Osi, A170
MMRRC Submission 043140-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5586 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 50199366-50210827 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 50203022 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 256 (D256G)
Ref Sequence ENSEMBL: ENSMUSP00000118662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015981] [ENSMUST00000020647] [ENSMUST00000102774] [ENSMUST00000136936] [ENSMUST00000143379]
AlphaFold Q64337
Predicted Effect probably damaging
Transcript: ENSMUST00000015981
AA Change: D256G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000015981
Gene: ENSMUSG00000015837
AA Change: D256G

DomainStartEndE-ValueType
PB1 3 102 1.96e-14 SMART
ZnF_ZZ 122 165 8.62e-19 SMART
low complexity region 269 281 N/A INTRINSIC
UBA 358 397 9.33e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000020647
Predicted Effect probably damaging
Transcript: ENSMUST00000102774
AA Change: D256G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099835
Gene: ENSMUSG00000015837
AA Change: D256G

DomainStartEndE-ValueType
PB1 3 102 1.96e-14 SMART
ZnF_ZZ 122 165 8.62e-19 SMART
low complexity region 269 281 N/A INTRINSIC
UBA 396 435 9.33e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131214
Predicted Effect probably benign
Transcript: ENSMUST00000136936
SMART Domains Protein: ENSMUSP00000120442
Gene: ENSMUSG00000015837

DomainStartEndE-ValueType
UBA 63 102 9.33e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143379
AA Change: D256G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118662
Gene: ENSMUSG00000015837
AA Change: D256G

DomainStartEndE-ValueType
PB1 3 102 1.96e-14 SMART
ZnF_ZZ 122 165 8.62e-19 SMART
low complexity region 269 281 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154805
Meta Mutation Damage Score 0.4980 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multifunctional protein that binds ubiquitin and regulates activation of the nuclear factor kappa-B (NF-kB) signaling pathway. The protein functions as a scaffolding/adaptor protein in concert with TNF receptor-associated factor 6 to mediate activation of NF-kB in response to upstream signals. Alternatively spliced transcript variants encoding either the same or different isoforms have been identified for this gene. Mutations in this gene result in sporadic and familial Paget disease of bone. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit impaired osteoclastogenesis in response to osteoclastogenic factors. Mice homozygous and heterozygous for a knock-in allele exhibit osteolytic lesion with increased bone formation, mineral apposition rate,and osteoclast numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,577,728 noncoding transcript Het
Aaas A T 15: 102,346,676 probably null Het
Abcc3 G A 11: 94,364,421 R600W probably damaging Het
Abhd13 A T 8: 9,988,318 Q305L probably benign Het
Adcy5 A T 16: 35,157,116 I340F probably damaging Het
Adgrl3 T A 5: 81,724,147 I964N probably damaging Het
Anks1b T A 10: 90,077,064 H316Q probably damaging Het
Ap3d1 A T 10: 80,719,130 F454I possibly damaging Het
Apol7c T C 15: 77,526,399 R116G possibly damaging Het
Arhgap5 A G 12: 52,519,912 E1222G possibly damaging Het
AW551984 A G 9: 39,591,263 V673A probably benign Het
Baiap2l1 A G 5: 144,282,139 S220P probably damaging Het
Bcl6 A G 16: 23,973,176 F143L probably benign Het
Calb1 A T 4: 15,900,811 T165S probably benign Het
Ccdc66 C A 14: 27,506,711 G6C probably damaging Het
Ccdc88a A G 11: 29,503,484 I344V probably benign Het
Cdh19 T A 1: 110,929,857 D249V probably damaging Het
Ces1c T A 8: 93,127,599 T103S probably benign Het
Cfap54 T A 10: 92,972,611 K1401* probably null Het
Copa T A 1: 172,105,222 N371K probably damaging Het
Cyp2b10 A T 7: 25,917,012 Y348F probably damaging Het
Dennd5a T C 7: 109,905,721 R861G possibly damaging Het
Dhx8 T C 11: 101,733,036 probably benign Het
Dido1 C T 2: 180,659,652 W2153* probably null Het
Dlgap1 T A 17: 70,818,161 V969D probably damaging Het
Dvl3 A G 16: 20,517,289 D32G probably damaging Het
Epdr1 T C 13: 19,594,548 D24G probably benign Het
Etnk2 T A 1: 133,379,305 probably null Het
Fam129a C T 1: 151,717,556 T664I probably benign Het
Fhad1 C T 4: 141,905,131 M1232I probably benign Het
Gcnt2 A C 13: 40,860,953 E200A probably damaging Het
Gm12800 T A 4: 101,910,120 F189I probably benign Het
Gm5174 A G 10: 86,656,545 noncoding transcript Het
Gm6408 T A 5: 146,484,457 F299I possibly damaging Het
Gpr85 G T 6: 13,836,001 Y301* probably null Het
Gucy2e G T 11: 69,226,256 P780T probably damaging Het
Icam5 A T 9: 21,034,820 N316I probably damaging Het
Ifit1bl1 C T 19: 34,594,277 R260Q probably damaging Het
Il1r1 A C 1: 40,225,251 probably benign Het
Kif3c A T 12: 3,389,656 I86F probably benign Het
Klhdc2 A G 12: 69,307,693 probably null Het
Mast2 A G 4: 116,435,563 L9P probably damaging Het
Mcoln1 G T 8: 3,510,389 C316F probably damaging Het
Mon1a A T 9: 107,898,695 D4V probably damaging Het
Ms4a18 T A 19: 11,013,674 M19L probably benign Het
Nbea T C 3: 55,631,971 K2790E probably benign Het
Noc3l C T 19: 38,814,695 E167K possibly damaging Het
Nol10 G A 12: 17,416,828 E570K possibly damaging Het
Nr2e3 T C 9: 59,949,201 R69G probably damaging Het
Obscn G A 11: 59,001,468 R1358* probably null Het
Olfr115 A T 17: 37,610,254 F166I probably damaging Het
Olfr1472 A T 19: 13,454,382 M45K probably benign Het
Olfr1535 C A 13: 21,555,096 V309F probably damaging Het
Olfr675 A G 7: 105,024,221 I253T probably damaging Het
Pak2 A T 16: 32,041,519 D175E probably benign Het
Pccb C T 9: 100,985,803 V357I possibly damaging Het
Pcdhb4 C T 18: 37,308,981 P448L probably damaging Het
Pcdhb9 A G 18: 37,401,114 M54V probably benign Het
Ppp3cb A G 14: 20,520,690 probably benign Het
Ppp4r1 A G 17: 65,824,568 D452G probably benign Het
Prmt3 T A 7: 49,826,751 D369E probably damaging Het
Psmd12 T A 11: 107,486,475 V120D probably benign Het
Ptprb T C 10: 116,353,827 L1797P probably damaging Het
Ptprm A G 17: 66,920,196 S653P probably damaging Het
Pxdn T A 12: 30,003,142 V926D probably damaging Het
Retreg3 T G 11: 101,106,339 Q105P probably damaging Het
Sacs A T 14: 61,206,441 R1979* probably null Het
Scn2a T A 2: 65,707,295 L696* probably null Het
Sema3c A T 5: 17,711,424 N465Y probably damaging Het
Slc25a32 A T 15: 39,099,913 V171E possibly damaging Het
Slc30a7 C T 3: 115,990,051 V158I probably benign Het
Slc44a5 G A 3: 154,270,165 probably benign Het
Slc4a8 A G 15: 100,787,164 D140G probably damaging Het
Slc7a11 G A 3: 50,443,083 S60L possibly damaging Het
Spryd3 A T 15: 102,131,937 H59Q probably benign Het
Sst A T 16: 23,889,737 S115T probably damaging Het
Surf1 T C 2: 26,915,951 probably benign Het
Synj1 A T 16: 91,009,977 probably benign Het
Tet1 C A 10: 62,878,294 C574F probably damaging Het
Thnsl1 T A 2: 21,212,390 Y318* probably null Het
Tmem110 A G 14: 30,870,819 K166E probably damaging Het
Tomm70a A G 16: 57,122,130 E90G probably damaging Het
Treml4 A G 17: 48,264,899 D110G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl1 C T 18: 63,664,325 G283D probably damaging Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Usp4 T C 9: 108,356,462 V94A possibly damaging Het
Vmn2r25 A C 6: 123,825,296 C549W probably damaging Het
Vmn2r59 G T 7: 42,045,681 Q436K probably benign Het
Wdr70 A T 15: 7,884,288 Y627N possibly damaging Het
Xpr1 T C 1: 155,312,863 I344V probably benign Het
Zfp423 T A 8: 87,859,340 Q61L possibly damaging Het
Other mutations in Sqstm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1694:Sqstm1 UTSW 11 50207480 missense probably benign 0.00
R2099:Sqstm1 UTSW 11 50202984 missense possibly damaging 0.75
R4448:Sqstm1 UTSW 11 50203039 splice site probably benign
R5577:Sqstm1 UTSW 11 50207439 missense probably benign
R6042:Sqstm1 UTSW 11 50207424 missense probably benign 0.16
R6285:Sqstm1 UTSW 11 50202591 nonsense probably null
R7111:Sqstm1 UTSW 11 50202591 missense probably benign 0.01
R7702:Sqstm1 UTSW 11 50206105 critical splice acceptor site probably null
R8246:Sqstm1 UTSW 11 50210561 missense probably damaging 0.96
R8733:Sqstm1 UTSW 11 50210666 missense possibly damaging 0.95
R9013:Sqstm1 UTSW 11 50207857 missense probably damaging 1.00
R9339:Sqstm1 UTSW 11 50200898 missense probably benign
X0065:Sqstm1 UTSW 11 50200839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGTCAGAGACTGAGCAG -3'
(R):5'- CACCTAGAGCTATGTGGTTCTG -3'

Sequencing Primer
(F):5'- AGACTGAGCAGGGCCCTC -3'
(R):5'- GTAAGTACACTGTAGCTGTCCTCAG -3'
Posted On 2016-10-26