Incidental Mutation 'R5586:Obscn'
ID 438739
Institutional Source Beutler Lab
Gene Symbol Obscn
Ensembl Gene ENSMUSG00000061462
Gene Name obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms OTTMUSG00000005786, LOC380698
MMRRC Submission 043140-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.777) question?
Stock # R5586 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 58885082-59027201 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 58892294 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 1358 (R1358*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047441]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000047441
AA Change: R6838*
SMART Domains Protein: ENSMUSP00000038264
Gene: ENSMUSG00000061462
AA Change: R6838*

DomainStartEndE-ValueType
IGc2 21 88 8e-12 SMART
IGc2 121 190 8.31e-10 SMART
low complexity region 191 207 N/A INTRINSIC
IGc2 248 316 4.63e-8 SMART
IG 337 417 5.32e-8 SMART
IG_like 425 506 1.5e2 SMART
FN3 510 596 2.11e-9 SMART
IG 711 790 2.39e-1 SMART
IGc2 876 942 2.54e-5 SMART
IGc2 968 1034 2.54e-5 SMART
IGc2 1060 1126 4.49e-6 SMART
IGc2 1152 1218 7.82e-6 SMART
IGc2 1244 1310 5.16e-6 SMART
IGc2 1336 1402 1.93e-5 SMART
IGc2 1428 1494 1.93e-5 SMART
IGc2 1520 1586 1.93e-5 SMART
IGc2 1612 1678 1.93e-5 SMART
IGc2 1704 1770 1.93e-5 SMART
IGc2 1796 1862 7.94e-7 SMART
IG 1882 1962 5.37e-4 SMART
IG 1972 2051 9.93e-8 SMART
IG 2062 2141 2.48e-8 SMART
IG 2151 2230 3.89e-1 SMART
IG 2240 2319 1.92e0 SMART
IG 2329 2407 6.45e-7 SMART
IG 2452 2531 1.22e-7 SMART
IGc2 2637 2703 9.93e-8 SMART
low complexity region 2705 2716 N/A INTRINSIC
IG 2720 2799 2.44e0 SMART
IGc2 2815 2881 2.1e-6 SMART
IG 2898 2979 2.86e0 SMART
IGc2 2995 3061 8.38e-6 SMART
IG 3078 3157 1.2e-6 SMART
IG 3167 3248 1.42e-3 SMART
IGc2 3264 3330 3.85e-5 SMART
IGc2 3353 3419 3.13e-5 SMART
IGc2 3442 3507 3.3e-4 SMART
IGc2 3530 3595 5.84e-5 SMART
IGc2 3618 3683 1.29e-6 SMART
IG_like 3706 3771 3.16e-1 SMART
IGc2 3779 3844 1.46e-5 SMART
IGc2 3867 3932 1.56e-5 SMART
IGc2 3955 4020 1.19e-5 SMART
IGc2 4043 4108 1.93e-5 SMART
IG 4125 4203 1.85e-7 SMART
IGc2 4219 4285 5.08e-5 SMART
IGc2 4308 4374 1.11e-5 SMART
IGc2 4397 4465 6.71e-5 SMART
IG 4482 4564 2.06e-5 SMART
IG 4574 4655 5.01e-4 SMART
IG 4664 4746 1.04e-1 SMART
FN3 4749 4831 2.44e-14 SMART
IG 4858 4940 3.68e-2 SMART
IQ 5100 5122 3.65e-4 SMART
IGc2 5139 5207 8.72e-4 SMART
low complexity region 5215 5231 N/A INTRINSIC
low complexity region 5232 5248 N/A INTRINSIC
low complexity region 5251 5274 N/A INTRINSIC
IGc2 5369 5437 3.25e-12 SMART
low complexity region 5450 5466 N/A INTRINSIC
IG 5496 5580 1.55e0 SMART
IGc2 5612 5685 1.82e-6 SMART
low complexity region 5799 5829 N/A INTRINSIC
SH3 5832 5895 1.22e0 SMART
Pfam:RhoGEF 5926 6104 4.5e-21 PFAM
PH 6125 6235 2.74e-11 SMART
IGc2 6255 6323 3.73e-12 SMART
IGc2 6349 6418 1.18e-14 SMART
IGc2 6464 6531 1.7e-6 SMART
S_TKc 6562 6815 1.66e-79 SMART
Blast:STYKc 6843 6935 5e-39 BLAST
low complexity region 6939 6954 N/A INTRINSIC
low complexity region 7013 7029 N/A INTRINSIC
low complexity region 7146 7161 N/A INTRINSIC
low complexity region 7199 7219 N/A INTRINSIC
low complexity region 7499 7514 N/A INTRINSIC
IGc2 7538 7606 6.3e-10 SMART
FN3 7620 7698 9.33e-2 SMART
STYKc 7736 7988 8.55e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101162
Predicted Effect probably null
Transcript: ENSMUST00000138587
AA Change: R1358*
SMART Domains Protein: ENSMUSP00000121092
Gene: ENSMUSG00000061462
AA Change: R1358*

DomainStartEndE-ValueType
IG 2 83 1.28e-1 SMART
low complexity region 186 216 N/A INTRINSIC
SH3 219 282 1.22e0 SMART
Pfam:RhoGEF 313 491 6.1e-22 PFAM
PH 512 622 2.74e-11 SMART
IGc2 642 710 3.73e-12 SMART
IGc2 736 805 1.18e-14 SMART
low complexity region 843 857 N/A INTRINSIC
IGc2 985 1052 1.7e-6 SMART
S_TKc 1083 1336 1.66e-79 SMART
Blast:STYKc 1364 1456 1e-38 BLAST
low complexity region 1460 1475 N/A INTRINSIC
low complexity region 1534 1550 N/A INTRINSIC
low complexity region 1667 1682 N/A INTRINSIC
low complexity region 1720 1740 N/A INTRINSIC
low complexity region 2020 2035 N/A INTRINSIC
IGc2 2059 2127 6.3e-10 SMART
FN3 2141 2219 9.33e-2 SMART
STYKc 2257 2509 8.55e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162526
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: The obscurin gene spans more than 150 kb, contains over 80 exons and encodes a protein of approximately 800 kDa. The encoded protein contains 68 Ig domains, 2 fibronectin domains, 1 calcium/calmodulin-binding domain, 1 RhoGEF domain with an associated PH domain, and 2 serine-threonine kinase domains. This protein is one of three giant sacromeric signaling proteins that includes titin and nebulin. It may have a role in the organization of myofibrils during assembly and also may mediate interactions between the sarcoplasmic reticulum and myofibrils. Alternatively spliced transcript variants encoding different isoforms have been described although the full-length nature is not known for all splicing variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit centrally localized nuclei in muscle fibers and mild myopathy in aged mice. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,277,153 (GRCm39) noncoding transcript Het
Aaas A T 15: 102,255,111 (GRCm39) probably null Het
Abcc3 G A 11: 94,255,247 (GRCm39) R600W probably damaging Het
Abhd13 A T 8: 10,038,318 (GRCm39) Q305L probably benign Het
Adcy5 A T 16: 34,977,486 (GRCm39) I340F probably damaging Het
Adgrl3 T A 5: 81,871,994 (GRCm39) I964N probably damaging Het
Anks1b T A 10: 89,912,926 (GRCm39) H316Q probably damaging Het
Ap3d1 A T 10: 80,554,964 (GRCm39) F454I possibly damaging Het
Apol7c T C 15: 77,410,599 (GRCm39) R116G possibly damaging Het
Arhgap5 A G 12: 52,566,695 (GRCm39) E1222G possibly damaging Het
AW551984 A G 9: 39,502,559 (GRCm39) V673A probably benign Het
Baiap2l1 A G 5: 144,218,949 (GRCm39) S220P probably damaging Het
Bcl6 A G 16: 23,791,926 (GRCm39) F143L probably benign Het
Calb1 A T 4: 15,900,811 (GRCm39) T165S probably benign Het
Ccdc66 C A 14: 27,228,668 (GRCm39) G6C probably damaging Het
Ccdc88a A G 11: 29,453,484 (GRCm39) I344V probably benign Het
Cdh19 T A 1: 110,857,587 (GRCm39) D249V probably damaging Het
Ces1c T A 8: 93,854,227 (GRCm39) T103S probably benign Het
Cfap54 T A 10: 92,808,473 (GRCm39) K1401* probably null Het
Copa T A 1: 171,932,789 (GRCm39) N371K probably damaging Het
Cyp2b10 A T 7: 25,616,437 (GRCm39) Y348F probably damaging Het
Dennd5a T C 7: 109,504,928 (GRCm39) R861G possibly damaging Het
Dhx8 T C 11: 101,623,862 (GRCm39) probably benign Het
Dido1 C T 2: 180,301,445 (GRCm39) W2153* probably null Het
Dlgap1 T A 17: 71,125,156 (GRCm39) V969D probably damaging Het
Dvl3 A G 16: 20,336,039 (GRCm39) D32G probably damaging Het
Epdr1 T C 13: 19,778,718 (GRCm39) D24G probably benign Het
Etnk2 T A 1: 133,307,043 (GRCm39) probably null Het
Fhad1 C T 4: 141,632,442 (GRCm39) M1232I probably benign Het
Gcnt2 A C 13: 41,014,429 (GRCm39) E200A probably damaging Het
Gm5174 A G 10: 86,492,409 (GRCm39) noncoding transcript Het
Gm6408 T A 5: 146,421,267 (GRCm39) F299I possibly damaging Het
Gpr85 G T 6: 13,836,000 (GRCm39) Y301* probably null Het
Gucy2e G T 11: 69,117,082 (GRCm39) P780T probably damaging Het
Icam5 A T 9: 20,946,116 (GRCm39) N316I probably damaging Het
Ifit1bl1 C T 19: 34,571,677 (GRCm39) R260Q probably damaging Het
Il1r1 A C 1: 40,264,411 (GRCm39) probably benign Het
Kif3c A T 12: 3,439,656 (GRCm39) I86F probably benign Het
Klhdc2 A G 12: 69,354,467 (GRCm39) probably null Het
Mast2 A G 4: 116,292,760 (GRCm39) L9P probably damaging Het
Mcoln1 G T 8: 3,560,389 (GRCm39) C316F probably damaging Het
Mon1a A T 9: 107,775,894 (GRCm39) D4V probably damaging Het
Ms4a18 T A 19: 10,991,038 (GRCm39) M19L probably benign Het
Nbea T C 3: 55,539,392 (GRCm39) K2790E probably benign Het
Niban1 C T 1: 151,593,307 (GRCm39) T664I probably benign Het
Noc3l C T 19: 38,803,139 (GRCm39) E167K possibly damaging Het
Nol10 G A 12: 17,466,829 (GRCm39) E570K possibly damaging Het
Nr2e3 T C 9: 59,856,484 (GRCm39) R69G probably damaging Het
Or14j4 A T 17: 37,921,145 (GRCm39) F166I probably damaging Het
Or2b7 C A 13: 21,739,266 (GRCm39) V309F probably damaging Het
Or52e8b A G 7: 104,673,428 (GRCm39) I253T probably damaging Het
Or5b117 A T 19: 13,431,746 (GRCm39) M45K probably benign Het
Pak2 A T 16: 31,860,337 (GRCm39) D175E probably benign Het
Pccb C T 9: 100,867,856 (GRCm39) V357I possibly damaging Het
Pcdhb4 C T 18: 37,442,034 (GRCm39) P448L probably damaging Het
Pcdhb9 A G 18: 37,534,167 (GRCm39) M54V probably benign Het
Ppp3cb A G 14: 20,570,758 (GRCm39) probably benign Het
Ppp4r1 A G 17: 66,131,563 (GRCm39) D452G probably benign Het
Pramel18 T A 4: 101,767,317 (GRCm39) F189I probably benign Het
Prmt3 T A 7: 49,476,499 (GRCm39) D369E probably damaging Het
Psmd12 T A 11: 107,377,301 (GRCm39) V120D probably benign Het
Ptprb T C 10: 116,189,732 (GRCm39) L1797P probably damaging Het
Ptprm A G 17: 67,227,191 (GRCm39) S653P probably damaging Het
Pxdn T A 12: 30,053,141 (GRCm39) V926D probably damaging Het
Retreg3 T G 11: 100,997,165 (GRCm39) Q105P probably damaging Het
Sacs A T 14: 61,443,890 (GRCm39) R1979* probably null Het
Scn2a T A 2: 65,537,639 (GRCm39) L696* probably null Het
Sema3c A T 5: 17,916,422 (GRCm39) N465Y probably damaging Het
Slc25a32 A T 15: 38,963,308 (GRCm39) V171E possibly damaging Het
Slc30a7 C T 3: 115,783,700 (GRCm39) V158I probably benign Het
Slc44a5 G A 3: 153,975,802 (GRCm39) probably benign Het
Slc4a8 A G 15: 100,685,045 (GRCm39) D140G probably damaging Het
Slc7a11 G A 3: 50,397,532 (GRCm39) S60L possibly damaging Het
Spryd3 A T 15: 102,040,372 (GRCm39) H59Q probably benign Het
Sqstm1 T C 11: 50,093,849 (GRCm39) D256G probably damaging Het
Sst A T 16: 23,708,487 (GRCm39) S115T probably damaging Het
Stimate A G 14: 30,592,776 (GRCm39) K166E probably damaging Het
Surf1 T C 2: 26,805,963 (GRCm39) probably benign Het
Synj1 A T 16: 90,806,865 (GRCm39) probably benign Het
Tet1 C A 10: 62,714,073 (GRCm39) C574F probably damaging Het
Thnsl1 T A 2: 21,217,201 (GRCm39) Y318* probably null Het
Tomm70a A G 16: 56,942,493 (GRCm39) E90G probably damaging Het
Treml4 A G 17: 48,571,927 (GRCm39) D110G probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Txnl1 C T 18: 63,797,396 (GRCm39) G283D probably damaging Het
Uba6 T C 5: 86,282,906 (GRCm39) D559G probably damaging Het
Usp4 T C 9: 108,233,661 (GRCm39) V94A possibly damaging Het
Vmn2r25 A C 6: 123,802,255 (GRCm39) C549W probably damaging Het
Vmn2r59 G T 7: 41,695,105 (GRCm39) Q436K probably benign Het
Wdr70 A T 15: 7,913,769 (GRCm39) Y627N possibly damaging Het
Xpr1 T C 1: 155,188,609 (GRCm39) I344V probably benign Het
Zfp423 T A 8: 88,585,968 (GRCm39) Q61L possibly damaging Het
Other mutations in Obscn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Obscn APN 11 58,892,883 (GRCm39) missense probably benign 0.01
IGL00417:Obscn APN 11 58,897,614 (GRCm39) missense unknown
IGL01018:Obscn APN 11 59,018,895 (GRCm39) missense probably damaging 0.99
IGL01083:Obscn APN 11 58,926,919 (GRCm39) missense probably damaging 0.99
IGL01109:Obscn APN 11 59,024,588 (GRCm39) missense probably damaging 1.00
IGL01139:Obscn APN 11 58,969,178 (GRCm39) missense probably damaging 1.00
IGL01361:Obscn APN 11 58,919,715 (GRCm39) missense probably damaging 0.99
IGL01370:Obscn APN 11 58,886,389 (GRCm39) critical splice acceptor site probably null
IGL01409:Obscn APN 11 58,921,884 (GRCm39) missense probably damaging 1.00
IGL01432:Obscn APN 11 58,924,583 (GRCm39) missense probably benign 0.27
IGL01527:Obscn APN 11 58,955,243 (GRCm39) missense possibly damaging 0.83
IGL01543:Obscn APN 11 58,932,943 (GRCm39) missense probably benign 0.01
IGL01578:Obscn APN 11 58,890,506 (GRCm39) missense unknown
IGL01603:Obscn APN 11 58,928,631 (GRCm39) missense probably damaging 1.00
IGL01750:Obscn APN 11 58,922,465 (GRCm39) missense probably damaging 1.00
IGL01765:Obscn APN 11 59,006,610 (GRCm39) missense possibly damaging 0.58
IGL01805:Obscn APN 11 59,023,422 (GRCm39) missense probably damaging 0.99
IGL01816:Obscn APN 11 58,886,605 (GRCm39) splice site probably benign
IGL01885:Obscn APN 11 58,965,794 (GRCm39) missense possibly damaging 0.60
IGL01911:Obscn APN 11 58,899,421 (GRCm39) nonsense probably null
IGL01963:Obscn APN 11 58,911,367 (GRCm39) missense probably benign 0.16
IGL02012:Obscn APN 11 58,967,333 (GRCm39) missense probably benign 0.03
IGL02096:Obscn APN 11 58,971,530 (GRCm39) missense probably damaging 0.98
IGL02125:Obscn APN 11 58,913,188 (GRCm39) missense probably damaging 1.00
IGL02125:Obscn APN 11 58,984,152 (GRCm39) missense possibly damaging 0.95
IGL02203:Obscn APN 11 58,973,134 (GRCm39) missense probably damaging 1.00
IGL02232:Obscn APN 11 58,929,804 (GRCm39) missense probably damaging 0.97
IGL02262:Obscn APN 11 58,919,359 (GRCm39) missense possibly damaging 0.88
IGL02304:Obscn APN 11 58,967,448 (GRCm39) missense probably damaging 1.00
IGL02306:Obscn APN 11 58,890,497 (GRCm39) missense unknown
IGL02323:Obscn APN 11 58,899,348 (GRCm39) missense possibly damaging 0.51
IGL02341:Obscn APN 11 59,026,651 (GRCm39) missense probably benign 0.09
IGL02342:Obscn APN 11 58,891,914 (GRCm39) missense probably benign 0.00
IGL02352:Obscn APN 11 58,891,853 (GRCm39) missense probably benign 0.10
IGL02397:Obscn APN 11 58,967,725 (GRCm39) missense possibly damaging 0.67
IGL02405:Obscn APN 11 59,023,428 (GRCm39) missense probably damaging 0.96
IGL02427:Obscn APN 11 58,957,988 (GRCm39) missense probably damaging 1.00
IGL02479:Obscn APN 11 58,947,053 (GRCm39) splice site probably benign
IGL02512:Obscn APN 11 58,919,343 (GRCm39) missense probably damaging 1.00
IGL02566:Obscn APN 11 58,958,973 (GRCm39) missense probably damaging 1.00
IGL02613:Obscn APN 11 58,892,958 (GRCm39) missense probably benign 0.03
IGL02634:Obscn APN 11 58,945,611 (GRCm39) missense probably damaging 1.00
IGL02680:Obscn APN 11 58,890,846 (GRCm39) missense unknown
IGL02715:Obscn APN 11 58,971,137 (GRCm39) missense probably benign 0.25
IGL02718:Obscn APN 11 58,968,684 (GRCm39) missense probably damaging 1.00
IGL02723:Obscn APN 11 59,015,446 (GRCm39) missense probably benign 0.17
IGL02735:Obscn APN 11 58,984,175 (GRCm39) missense probably damaging 1.00
IGL02951:Obscn APN 11 58,885,339 (GRCm39) splice site probably benign
IGL03004:Obscn APN 11 58,919,413 (GRCm39) missense probably damaging 1.00
IGL03078:Obscn APN 11 58,969,624 (GRCm39) splice site probably null
IGL03114:Obscn APN 11 58,891,365 (GRCm39) missense unknown
IGL03125:Obscn APN 11 58,952,474 (GRCm39) missense probably damaging 1.00
IGL03150:Obscn APN 11 58,942,549 (GRCm39) missense probably damaging 1.00
IGL03156:Obscn APN 11 58,945,722 (GRCm39) missense probably damaging 1.00
IGL03169:Obscn APN 11 58,964,122 (GRCm39) missense probably damaging 1.00
IGL03297:Obscn APN 11 58,951,712 (GRCm39) missense possibly damaging 0.83
IGL03326:Obscn APN 11 58,923,728 (GRCm39) missense probably damaging 1.00
IGL03345:Obscn APN 11 58,886,308 (GRCm39) unclassified probably benign
IGL03348:Obscn APN 11 58,941,188 (GRCm39) missense probably damaging 1.00
IGL03355:Obscn APN 11 58,928,618 (GRCm39) missense probably damaging 1.00
IGL03377:Obscn APN 11 58,890,699 (GRCm39) missense probably damaging 1.00
IGL03396:Obscn APN 11 58,964,404 (GRCm39) missense probably benign 0.12
IGL03405:Obscn APN 11 58,890,950 (GRCm39) missense unknown
boeuf UTSW 11 59,024,020 (GRCm39) missense probably benign 0.37
Bull UTSW 11 58,923,744 (GRCm39) missense possibly damaging 0.85
Deluge UTSW 11 58,898,440 (GRCm39) missense unknown
ducking UTSW 11 58,971,795 (GRCm39) unclassified probably benign
Goose UTSW 11 58,941,306 (GRCm39) missense probably benign 0.23
Obscurity UTSW 11 58,885,526 (GRCm39) nonsense probably null
Tallow UTSW 11 58,967,819 (GRCm39) missense possibly damaging 0.95
Turducken UTSW 11 58,942,347 (GRCm39) splice site probably benign
BB001:Obscn UTSW 11 59,003,381 (GRCm39) missense probably benign 0.27
BB002:Obscn UTSW 11 59,003,381 (GRCm39) missense probably benign 0.27
BB011:Obscn UTSW 11 59,003,381 (GRCm39) missense probably benign 0.27
BB012:Obscn UTSW 11 59,003,381 (GRCm39) missense probably benign 0.27
IGL02802:Obscn UTSW 11 58,891,310 (GRCm39) missense unknown
N/A - 535:Obscn UTSW 11 58,891,134 (GRCm39) missense possibly damaging 0.67
PIT4131001:Obscn UTSW 11 58,957,890 (GRCm39) critical splice donor site probably null
PIT4453001:Obscn UTSW 11 58,960,660 (GRCm39) missense possibly damaging 0.76
PIT4453001:Obscn UTSW 11 58,951,802 (GRCm39) missense probably damaging 1.00
PIT4504001:Obscn UTSW 11 59,023,948 (GRCm39) missense probably damaging 1.00
PIT4651001:Obscn UTSW 11 58,932,507 (GRCm39) missense probably damaging 0.99
R0033:Obscn UTSW 11 58,885,572 (GRCm39) unclassified probably benign
R0041:Obscn UTSW 11 58,934,803 (GRCm39) missense probably damaging 1.00
R0042:Obscn UTSW 11 58,943,411 (GRCm39) missense probably damaging 1.00
R0064:Obscn UTSW 11 58,918,292 (GRCm39) missense probably damaging 1.00
R0064:Obscn UTSW 11 58,918,292 (GRCm39) missense probably damaging 1.00
R0071:Obscn UTSW 11 58,955,027 (GRCm39) missense possibly damaging 0.85
R0077:Obscn UTSW 11 58,942,347 (GRCm39) splice site probably benign
R0083:Obscn UTSW 11 58,913,200 (GRCm39) missense probably damaging 1.00
R0089:Obscn UTSW 11 58,890,888 (GRCm39) missense unknown
R0092:Obscn UTSW 11 58,942,073 (GRCm39) missense possibly damaging 0.96
R0103:Obscn UTSW 11 58,953,522 (GRCm39) nonsense probably null
R0103:Obscn UTSW 11 58,953,522 (GRCm39) nonsense probably null
R0108:Obscn UTSW 11 58,913,200 (GRCm39) missense probably damaging 1.00
R0152:Obscn UTSW 11 58,943,402 (GRCm39) missense probably benign 0.06
R0268:Obscn UTSW 11 58,958,098 (GRCm39) missense possibly damaging 0.78
R0271:Obscn UTSW 11 58,947,568 (GRCm39) intron probably benign
R0281:Obscn UTSW 11 58,929,441 (GRCm39) missense probably damaging 1.00
R0329:Obscn UTSW 11 58,943,332 (GRCm39) missense probably damaging 1.00
R0329:Obscn UTSW 11 58,931,267 (GRCm39) missense probably damaging 1.00
R0360:Obscn UTSW 11 59,019,107 (GRCm39) missense probably benign 0.22
R0364:Obscn UTSW 11 59,019,107 (GRCm39) missense probably benign 0.22
R0382:Obscn UTSW 11 58,931,132 (GRCm39) missense probably damaging 1.00
R0386:Obscn UTSW 11 59,027,165 (GRCm39) missense probably damaging 1.00
R0403:Obscn UTSW 11 58,967,366 (GRCm39) missense probably damaging 1.00
R0413:Obscn UTSW 11 58,893,823 (GRCm39) missense probably benign 0.03
R0437:Obscn UTSW 11 58,885,914 (GRCm39) unclassified probably benign
R0442:Obscn UTSW 11 58,893,000 (GRCm39) splice site probably benign
R0445:Obscn UTSW 11 58,890,161 (GRCm39) missense unknown
R0446:Obscn UTSW 11 58,886,238 (GRCm39) unclassified probably benign
R0454:Obscn UTSW 11 58,890,449 (GRCm39) missense unknown
R0463:Obscn UTSW 11 58,952,356 (GRCm39) missense probably benign 0.07
R0479:Obscn UTSW 11 59,003,533 (GRCm39) missense probably damaging 1.00
R0480:Obscn UTSW 11 59,024,772 (GRCm39) nonsense probably null
R0504:Obscn UTSW 11 58,899,333 (GRCm39) critical splice donor site probably null
R0507:Obscn UTSW 11 58,920,167 (GRCm39) missense probably damaging 1.00
R0513:Obscn UTSW 11 58,952,348 (GRCm39) missense possibly damaging 0.81
R0541:Obscn UTSW 11 58,972,810 (GRCm39) missense probably damaging 1.00
R0551:Obscn UTSW 11 58,998,688 (GRCm39) nonsense probably null
R0573:Obscn UTSW 11 58,926,905 (GRCm39) missense probably damaging 1.00
R0599:Obscn UTSW 11 58,964,522 (GRCm39) missense probably damaging 1.00
R0637:Obscn UTSW 11 58,973,602 (GRCm39) missense probably damaging 0.96
R0637:Obscn UTSW 11 58,942,470 (GRCm39) missense probably damaging 1.00
R0653:Obscn UTSW 11 58,898,534 (GRCm39) unclassified probably benign
R0712:Obscn UTSW 11 58,940,271 (GRCm39) missense possibly damaging 0.72
R0715:Obscn UTSW 11 58,941,306 (GRCm39) missense probably benign 0.23
R0729:Obscn UTSW 11 58,923,535 (GRCm39) missense probably damaging 1.00
R0741:Obscn UTSW 11 58,954,279 (GRCm39) frame shift probably null
R0745:Obscn UTSW 11 58,973,065 (GRCm39) missense probably benign 0.14
R0751:Obscn UTSW 11 58,972,645 (GRCm39) missense probably damaging 1.00
R0834:Obscn UTSW 11 59,024,104 (GRCm39) missense probably benign 0.25
R0863:Obscn UTSW 11 58,886,241 (GRCm39) unclassified probably benign
R0909:Obscn UTSW 11 58,965,890 (GRCm39) missense probably damaging 1.00
R0965:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R0969:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R0980:Obscn UTSW 11 58,888,887 (GRCm39) missense possibly damaging 0.92
R1017:Obscn UTSW 11 58,889,179 (GRCm39) missense unknown
R1103:Obscn UTSW 11 58,912,309 (GRCm39) missense probably damaging 1.00
R1107:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R1128:Obscn UTSW 11 58,919,769 (GRCm39) missense probably null 0.71
R1164:Obscn UTSW 11 58,926,913 (GRCm39) missense possibly damaging 0.65
R1192:Obscn UTSW 11 58,958,025 (GRCm39) missense probably benign 0.33
R1298:Obscn UTSW 11 58,945,723 (GRCm39) missense possibly damaging 0.65
R1331:Obscn UTSW 11 58,977,754 (GRCm39) missense probably benign 0.09
R1333:Obscn UTSW 11 58,971,143 (GRCm39) missense probably damaging 0.99
R1341:Obscn UTSW 11 58,920,198 (GRCm39) splice site probably benign
R1385:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R1386:Obscn UTSW 11 59,024,679 (GRCm39) missense probably damaging 1.00
R1390:Obscn UTSW 11 58,984,274 (GRCm39) missense probably damaging 1.00
R1460:Obscn UTSW 11 58,946,792 (GRCm39) missense probably damaging 1.00
R1495:Obscn UTSW 11 58,970,986 (GRCm39) missense probably damaging 0.99
R1496:Obscn UTSW 11 58,921,862 (GRCm39) missense probably benign 0.01
R1524:Obscn UTSW 11 59,006,681 (GRCm39) missense probably damaging 1.00
R1526:Obscn UTSW 11 58,919,412 (GRCm39) missense probably damaging 1.00
R1537:Obscn UTSW 11 58,891,575 (GRCm39) missense unknown
R1554:Obscn UTSW 11 58,894,474 (GRCm39) missense unknown
R1561:Obscn UTSW 11 58,926,899 (GRCm39) missense probably damaging 1.00
R1589:Obscn UTSW 11 58,926,901 (GRCm39) missense possibly damaging 0.89
R1615:Obscn UTSW 11 58,990,651 (GRCm39) missense probably benign 0.09
R1627:Obscn UTSW 11 59,003,464 (GRCm39) missense probably benign 0.14
R1634:Obscn UTSW 11 58,967,722 (GRCm39) missense probably damaging 1.00
R1636:Obscn UTSW 11 59,013,463 (GRCm39) missense probably damaging 1.00
R1681:Obscn UTSW 11 58,994,151 (GRCm39) missense probably damaging 1.00
R1686:Obscn UTSW 11 58,997,113 (GRCm39) splice site probably benign
R1713:Obscn UTSW 11 58,970,712 (GRCm39) missense probably damaging 1.00
R1730:Obscn UTSW 11 58,964,459 (GRCm39) missense probably damaging 1.00
R1781:Obscn UTSW 11 58,997,163 (GRCm39) missense probably damaging 1.00
R1783:Obscn UTSW 11 58,964,459 (GRCm39) missense probably damaging 1.00
R1793:Obscn UTSW 11 58,968,606 (GRCm39) missense probably damaging 1.00
R1796:Obscn UTSW 11 58,920,163 (GRCm39) missense possibly damaging 0.94
R1801:Obscn UTSW 11 58,889,147 (GRCm39) missense unknown
R1824:Obscn UTSW 11 58,885,658 (GRCm39) unclassified probably benign
R1856:Obscn UTSW 11 58,931,122 (GRCm39) missense probably damaging 1.00
R1866:Obscn UTSW 11 58,951,741 (GRCm39) missense probably benign 0.34
R1878:Obscn UTSW 11 58,886,379 (GRCm39) missense probably damaging 0.99
R1883:Obscn UTSW 11 58,969,029 (GRCm39) missense probably damaging 1.00
R1926:Obscn UTSW 11 58,954,300 (GRCm39) missense
R1967:Obscn UTSW 11 59,026,535 (GRCm39) nonsense probably null
R1975:Obscn UTSW 11 58,958,555 (GRCm39) missense probably damaging 1.00
R1992:Obscn UTSW 11 58,886,653 (GRCm39) unclassified probably benign
R2021:Obscn UTSW 11 58,958,000 (GRCm39) missense probably benign 0.40
R2066:Obscn UTSW 11 59,026,558 (GRCm39) missense possibly damaging 0.59
R2074:Obscn UTSW 11 59,023,478 (GRCm39) missense probably damaging 1.00
R2074:Obscn UTSW 11 58,960,107 (GRCm39) missense probably damaging 0.99
R2081:Obscn UTSW 11 58,925,008 (GRCm39) missense possibly damaging 0.90
R2083:Obscn UTSW 11 58,964,457 (GRCm39) nonsense probably null
R2086:Obscn UTSW 11 58,969,082 (GRCm39) missense probably damaging 0.99
R2095:Obscn UTSW 11 58,984,410 (GRCm39) splice site probably null
R2098:Obscn UTSW 11 58,960,817 (GRCm39) missense probably damaging 1.00
R2114:Obscn UTSW 11 59,022,484 (GRCm39) missense probably damaging 0.99
R2138:Obscn UTSW 11 58,894,491 (GRCm39) nonsense probably null
R2193:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2194:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2210:Obscn UTSW 11 58,958,913 (GRCm39) missense probably damaging 1.00
R2233:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2234:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2287:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2288:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2351:Obscn UTSW 11 59,003,438 (GRCm39) missense probably damaging 0.99
R2376:Obscn UTSW 11 58,959,950 (GRCm39) missense probably damaging 1.00
R2384:Obscn UTSW 11 58,933,663 (GRCm39) critical splice donor site probably null
R2401:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2402:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2403:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2424:Obscn UTSW 11 58,885,277 (GRCm39) unclassified probably benign
R2433:Obscn UTSW 11 58,929,912 (GRCm39) splice site probably null
R2445:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2446:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2447:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2449:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2483:Obscn UTSW 11 58,970,972 (GRCm39) missense probably damaging 1.00
R2484:Obscn UTSW 11 58,898,366 (GRCm39) unclassified probably benign
R2496:Obscn UTSW 11 58,994,268 (GRCm39) missense probably damaging 1.00
R2510:Obscn UTSW 11 58,933,140 (GRCm39) splice site probably benign
R2851:Obscn UTSW 11 58,920,844 (GRCm39) critical splice donor site probably null
R2878:Obscn UTSW 11 58,947,014 (GRCm39) missense possibly damaging 0.94
R2879:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2885:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2885:Obscn UTSW 11 58,977,574 (GRCm39) missense probably damaging 1.00
R2886:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2985:Obscn UTSW 11 59,023,915 (GRCm39) missense probably damaging 1.00
R3013:Obscn UTSW 11 58,951,744 (GRCm39) missense probably damaging 1.00
R3118:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R3236:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R3237:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R3432:Obscn UTSW 11 58,922,003 (GRCm39) missense probably damaging 1.00
R3694:Obscn UTSW 11 58,969,221 (GRCm39) missense probably damaging 1.00
R3716:Obscn UTSW 11 58,973,487 (GRCm39) missense probably damaging 1.00
R3717:Obscn UTSW 11 58,973,487 (GRCm39) missense probably damaging 1.00
R3743:Obscn UTSW 11 58,969,911 (GRCm39) missense probably damaging 0.99
R3760:Obscn UTSW 11 58,919,406 (GRCm39) missense probably damaging 1.00
R3795:Obscn UTSW 11 58,922,667 (GRCm39) missense probably damaging 1.00
R3857:Obscn UTSW 11 58,971,795 (GRCm39) unclassified probably benign
R3858:Obscn UTSW 11 58,971,795 (GRCm39) unclassified probably benign
R3862:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R3863:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R3864:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R3881:Obscn UTSW 11 58,947,775 (GRCm39) missense probably damaging 1.00
R3890:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R3903:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R3923:Obscn UTSW 11 58,951,754 (GRCm39) missense possibly damaging 0.96
R3944:Obscn UTSW 11 59,023,373 (GRCm39) missense probably damaging 1.00
R3947:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R3948:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R3955:Obscn UTSW 11 58,927,594 (GRCm39) missense probably damaging 1.00
R3970:Obscn UTSW 11 58,942,488 (GRCm39) missense probably damaging 1.00
R3971:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R4001:Obscn UTSW 11 59,025,395 (GRCm39) missense probably damaging 1.00
R4005:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R4017:Obscn UTSW 11 59,023,448 (GRCm39) missense probably damaging 1.00
R4028:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R4029:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R4041:Obscn UTSW 11 58,942,357 (GRCm39) nonsense probably null
R4061:Obscn UTSW 11 58,899,358 (GRCm39) missense probably damaging 1.00
R4062:Obscn UTSW 11 58,973,536 (GRCm39) missense probably damaging 0.99
R4072:Obscn UTSW 11 58,888,009 (GRCm39) missense unknown
R4078:Obscn UTSW 11 58,929,189 (GRCm39) missense probably benign 0.41
R4079:Obscn UTSW 11 58,929,189 (GRCm39) missense probably benign 0.41
R4092:Obscn UTSW 11 58,946,886 (GRCm39) missense probably benign 0.12
R4106:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R4108:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R4403:Obscn UTSW 11 58,959,919 (GRCm39) missense possibly damaging 0.95
R4477:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R4478:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R4480:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R4489:Obscn UTSW 11 58,922,417 (GRCm39) missense possibly damaging 0.74
R4531:Obscn UTSW 11 58,898,700 (GRCm39) unclassified probably benign
R4551:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R4552:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R4553:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R4558:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R4570:Obscn UTSW 11 58,897,654 (GRCm39) splice site probably null
R4575:Obscn UTSW 11 59,013,598 (GRCm39) missense probably damaging 0.99
R4593:Obscn UTSW 11 59,024,075 (GRCm39) missense probably damaging 1.00
R4604:Obscn UTSW 11 59,013,572 (GRCm39) missense probably damaging 0.96
R4604:Obscn UTSW 11 58,971,031 (GRCm39) missense probably damaging 1.00
R4625:Obscn UTSW 11 58,958,084 (GRCm39) missense probably damaging 1.00
R4646:Obscn UTSW 11 59,015,396 (GRCm39) nonsense probably null
R4651:Obscn UTSW 11 58,929,703 (GRCm39) missense probably damaging 1.00
R4652:Obscn UTSW 11 58,929,703 (GRCm39) missense probably damaging 1.00
R4657:Obscn UTSW 11 58,933,116 (GRCm39) missense probably damaging 1.00
R4658:Obscn UTSW 11 58,945,114 (GRCm39) nonsense probably null
R4662:Obscn UTSW 11 58,890,422 (GRCm39) missense unknown
R4665:Obscn UTSW 11 59,015,578 (GRCm39) missense probably damaging 1.00
R4718:Obscn UTSW 11 58,912,780 (GRCm39) missense probably damaging 1.00
R4736:Obscn UTSW 11 58,954,362 (GRCm39) missense probably damaging 1.00
R4746:Obscn UTSW 11 58,970,634 (GRCm39) critical splice donor site probably null
R4754:Obscn UTSW 11 58,926,869 (GRCm39) missense possibly damaging 0.81
R4758:Obscn UTSW 11 58,894,189 (GRCm39) missense unknown
R4758:Obscn UTSW 11 59,026,743 (GRCm39) missense probably damaging 0.98
R4766:Obscn UTSW 11 58,903,568 (GRCm39) missense probably damaging 1.00
R4798:Obscn UTSW 11 58,960,685 (GRCm39) missense probably damaging 0.99
R4810:Obscn UTSW 11 58,922,417 (GRCm39) missense possibly damaging 0.74
R4819:Obscn UTSW 11 58,929,674 (GRCm39) missense probably damaging 0.97
R4821:Obscn UTSW 11 58,931,293 (GRCm39) missense probably damaging 1.00
R4821:Obscn UTSW 11 58,897,652 (GRCm39) splice site probably benign
R4822:Obscn UTSW 11 58,913,159 (GRCm39) missense probably benign 0.11
R4828:Obscn UTSW 11 58,977,496 (GRCm39) missense possibly damaging 0.93
R4829:Obscn UTSW 11 58,945,072 (GRCm39) missense probably null 0.53
R4830:Obscn UTSW 11 58,958,433 (GRCm39) missense probably damaging 1.00
R4859:Obscn UTSW 11 58,972,849 (GRCm39) missense possibly damaging 0.89
R4870:Obscn UTSW 11 59,027,032 (GRCm39) missense probably damaging 1.00
R4909:Obscn UTSW 11 58,952,291 (GRCm39) missense possibly damaging 0.52
R4955:Obscn UTSW 11 58,959,998 (GRCm39) missense probably benign 0.31
R4973:Obscn UTSW 11 59,023,292 (GRCm39) missense probably damaging 1.00
R4993:Obscn UTSW 11 59,015,587 (GRCm39) missense possibly damaging 0.48
R5034:Obscn UTSW 11 58,952,502 (GRCm39) nonsense probably null
R5054:Obscn UTSW 11 58,964,443 (GRCm39) missense probably damaging 1.00
R5077:Obscn UTSW 11 58,934,883 (GRCm39) missense probably damaging 0.98
R5126:Obscn UTSW 11 58,967,889 (GRCm39) missense probably damaging 1.00
R5135:Obscn UTSW 11 59,020,479 (GRCm39) missense probably damaging 1.00
R5161:Obscn UTSW 11 58,955,136 (GRCm39) missense possibly damaging 0.60
R5161:Obscn UTSW 11 58,919,430 (GRCm39) missense probably damaging 1.00
R5195:Obscn UTSW 11 58,951,676 (GRCm39) missense possibly damaging 0.78
R5222:Obscn UTSW 11 58,934,971 (GRCm39) missense possibly damaging 0.80
R5260:Obscn UTSW 11 58,894,195 (GRCm39) missense probably damaging 1.00
R5301:Obscn UTSW 11 59,026,234 (GRCm39) missense probably damaging 1.00
R5305:Obscn UTSW 11 58,903,541 (GRCm39) missense possibly damaging 0.83
R5323:Obscn UTSW 11 58,887,703 (GRCm39) missense probably benign
R5333:Obscn UTSW 11 58,953,518 (GRCm39) missense probably damaging 1.00
R5366:Obscn UTSW 11 58,971,086 (GRCm39) missense probably damaging 1.00
R5368:Obscn UTSW 11 58,959,852 (GRCm39) critical splice donor site probably null
R5408:Obscn UTSW 11 58,942,437 (GRCm39) missense probably damaging 1.00
R5439:Obscn UTSW 11 58,890,954 (GRCm39) nonsense probably null
R5536:Obscn UTSW 11 58,998,697 (GRCm39) missense probably damaging 1.00
R5561:Obscn UTSW 11 58,926,919 (GRCm39) missense probably damaging 0.99
R5573:Obscn UTSW 11 58,925,531 (GRCm39) missense possibly damaging 0.94
R5582:Obscn UTSW 11 58,990,802 (GRCm39) splice site probably null
R5607:Obscn UTSW 11 59,013,674 (GRCm39) missense probably benign 0.22
R5700:Obscn UTSW 11 59,024,020 (GRCm39) missense probably benign 0.37
R5706:Obscn UTSW 11 58,967,082 (GRCm39) missense probably damaging 1.00
R5718:Obscn UTSW 11 58,927,634 (GRCm39) missense probably damaging 1.00
R5771:Obscn UTSW 11 58,891,533 (GRCm39) missense unknown
R5772:Obscn UTSW 11 58,946,970 (GRCm39) missense probably damaging 0.99
R5786:Obscn UTSW 11 58,923,517 (GRCm39) missense probably damaging 1.00
R5807:Obscn UTSW 11 58,970,476 (GRCm39) missense probably damaging 1.00
R5815:Obscn UTSW 11 58,973,015 (GRCm39) splice site probably null
R5835:Obscn UTSW 11 58,932,953 (GRCm39) missense probably damaging 1.00
R5835:Obscn UTSW 11 58,892,907 (GRCm39) missense probably benign 0.03
R5846:Obscn UTSW 11 58,929,435 (GRCm39) missense probably damaging 1.00
R5851:Obscn UTSW 11 58,885,526 (GRCm39) nonsense probably null
R5933:Obscn UTSW 11 58,889,331 (GRCm39) missense unknown
R5935:Obscn UTSW 11 58,897,639 (GRCm39) missense unknown
R5974:Obscn UTSW 11 58,967,373 (GRCm39) missense probably damaging 1.00
R5975:Obscn UTSW 11 59,013,445 (GRCm39) critical splice donor site probably null
R6014:Obscn UTSW 11 58,929,690 (GRCm39) missense probably damaging 1.00
R6026:Obscn UTSW 11 58,957,916 (GRCm39) missense probably damaging 0.98
R6082:Obscn UTSW 11 58,890,393 (GRCm39) missense unknown
R6124:Obscn UTSW 11 58,969,870 (GRCm39) missense probably benign 0.45
R6130:Obscn UTSW 11 58,968,771 (GRCm39) missense possibly damaging 0.90
R6160:Obscn UTSW 11 58,942,611 (GRCm39) missense probably damaging 1.00
R6169:Obscn UTSW 11 58,891,325 (GRCm39) missense unknown
R6177:Obscn UTSW 11 58,923,490 (GRCm39) missense probably damaging 1.00
R6189:Obscn UTSW 11 58,960,760 (GRCm39) missense probably benign 0.00
R6192:Obscn UTSW 11 58,888,864 (GRCm39) missense unknown
R6195:Obscn UTSW 11 58,888,033 (GRCm39) missense probably damaging 0.98
R6208:Obscn UTSW 11 58,958,474 (GRCm39) missense possibly damaging 0.81
R6232:Obscn UTSW 11 58,943,337 (GRCm39) nonsense probably null
R6233:Obscn UTSW 11 58,888,033 (GRCm39) missense probably damaging 0.98
R6273:Obscn UTSW 11 58,967,819 (GRCm39) missense possibly damaging 0.95
R6280:Obscn UTSW 11 58,954,509 (GRCm39) missense possibly damaging 0.82
R6317:Obscn UTSW 11 58,960,721 (GRCm39) missense probably damaging 1.00
R6345:Obscn UTSW 11 58,944,522 (GRCm39) missense probably damaging 0.99
R6378:Obscn UTSW 11 58,964,572 (GRCm39) missense probably damaging 1.00
R6382:Obscn UTSW 11 58,933,034 (GRCm39) missense probably damaging 0.99
R6382:Obscn UTSW 11 58,890,239 (GRCm39) missense unknown
R6415:Obscn UTSW 11 58,925,956 (GRCm39) missense probably damaging 0.99
R6433:Obscn UTSW 11 58,942,384 (GRCm39) missense probably benign 0.14
R6457:Obscn UTSW 11 58,971,597 (GRCm39) missense probably damaging 0.99
R6508:Obscn UTSW 11 58,944,973 (GRCm39) splice site probably null
R6611:Obscn UTSW 11 58,955,056 (GRCm39) splice site probably null
R6614:Obscn UTSW 11 58,903,627 (GRCm39) missense probably benign 0.01
R6645:Obscn UTSW 11 58,976,088 (GRCm39) missense probably damaging 0.97
R6646:Obscn UTSW 11 58,973,544 (GRCm39) missense possibly damaging 0.72
R6659:Obscn UTSW 11 58,929,835 (GRCm39) missense probably damaging 1.00
R6723:Obscn UTSW 11 58,945,824 (GRCm39) missense probably damaging 0.99
R6733:Obscn UTSW 11 58,919,421 (GRCm39) missense probably damaging 0.99
R6755:Obscn UTSW 11 58,994,152 (GRCm39) missense probably damaging 1.00
R6770:Obscn UTSW 11 58,934,862 (GRCm39) missense possibly damaging 0.88
R6820:Obscn UTSW 11 58,942,019 (GRCm39) missense probably damaging 1.00
R6823:Obscn UTSW 11 58,958,769 (GRCm39) critical splice donor site probably null
R6850:Obscn UTSW 11 58,958,950 (GRCm39) missense possibly damaging 0.93
R6850:Obscn UTSW 11 58,892,955 (GRCm39) missense possibly damaging 0.92
R6862:Obscn UTSW 11 58,886,279 (GRCm39) unclassified probably benign
R6884:Obscn UTSW 11 58,969,128 (GRCm39) missense probably damaging 1.00
R6894:Obscn UTSW 11 59,023,508 (GRCm39) missense probably benign 0.43
R6906:Obscn UTSW 11 58,923,744 (GRCm39) missense possibly damaging 0.85
R6944:Obscn UTSW 11 58,929,756 (GRCm39) missense probably damaging 1.00
R6948:Obscn UTSW 11 58,997,142 (GRCm39) missense probably damaging 1.00
R6959:Obscn UTSW 11 58,928,411 (GRCm39) missense probably damaging 1.00
R7000:Obscn UTSW 11 59,026,864 (GRCm39) missense probably damaging 1.00
R7028:Obscn UTSW 11 58,969,959 (GRCm39) missense probably damaging 1.00
R7037:Obscn UTSW 11 58,943,430 (GRCm39) missense probably damaging 0.98
R7037:Obscn UTSW 11 58,934,755 (GRCm39) missense probably damaging 1.00
R7056:Obscn UTSW 11 58,887,122 (GRCm39) unclassified probably benign
R7112:Obscn UTSW 11 58,920,151 (GRCm39) missense
R7121:Obscn UTSW 11 58,904,078 (GRCm39) nonsense probably null
R7123:Obscn UTSW 11 58,904,477 (GRCm39) missense probably benign
R7182:Obscn UTSW 11 58,925,927 (GRCm39) missense probably damaging 0.99
R7199:Obscn UTSW 11 58,903,672 (GRCm39) missense probably benign 0.09
R7209:Obscn UTSW 11 58,975,933 (GRCm39) nonsense probably null
R7235:Obscn UTSW 11 58,971,666 (GRCm39) missense probably damaging 0.98
R7247:Obscn UTSW 11 58,994,144 (GRCm39) nonsense probably null
R7262:Obscn UTSW 11 59,006,715 (GRCm39) missense probably damaging 0.99
R7269:Obscn UTSW 11 58,933,838 (GRCm39) missense probably damaging 0.99
R7270:Obscn UTSW 11 58,920,312 (GRCm39) missense
R7274:Obscn UTSW 11 59,024,053 (GRCm39) missense probably damaging 1.00
R7312:Obscn UTSW 11 58,946,442 (GRCm39) missense probably benign 0.00
R7313:Obscn UTSW 11 58,898,414 (GRCm39) missense unknown
R7360:Obscn UTSW 11 58,973,185 (GRCm39) missense probably damaging 1.00
R7380:Obscn UTSW 11 58,947,740 (GRCm39) missense
R7389:Obscn UTSW 11 58,927,226 (GRCm39) missense probably benign 0.02
R7402:Obscn UTSW 11 58,886,275 (GRCm39) missense unknown
R7417:Obscn UTSW 11 59,020,403 (GRCm39) missense possibly damaging 0.93
R7432:Obscn UTSW 11 58,919,733 (GRCm39) missense
R7456:Obscn UTSW 11 58,899,384 (GRCm39) missense probably benign 0.01
R7459:Obscn UTSW 11 59,022,483 (GRCm39) missense probably benign 0.00
R7463:Obscn UTSW 11 59,013,686 (GRCm39) missense probably benign 0.02
R7478:Obscn UTSW 11 58,984,242 (GRCm39) missense probably damaging 1.00
R7498:Obscn UTSW 11 58,973,539 (GRCm39) missense probably damaging 1.00
R7502:Obscn UTSW 11 58,885,635 (GRCm39) missense unknown
R7509:Obscn UTSW 11 58,942,455 (GRCm39) missense probably benign 0.36
R7516:Obscn UTSW 11 59,015,416 (GRCm39) nonsense probably null
R7545:Obscn UTSW 11 58,929,725 (GRCm39) missense probably damaging 1.00
R7549:Obscn UTSW 11 58,933,664 (GRCm39) critical splice donor site probably null
R7582:Obscn UTSW 11 58,952,253 (GRCm39) nonsense probably null
R7607:Obscn UTSW 11 58,889,091 (GRCm39) missense unknown
R7609:Obscn UTSW 11 58,891,125 (GRCm39) missense unknown
R7647:Obscn UTSW 11 58,888,113 (GRCm39) critical splice acceptor site probably null
R7650:Obscn UTSW 11 58,951,820 (GRCm39) missense probably benign 0.01
R7673:Obscn UTSW 11 58,918,263 (GRCm39) missense
R7743:Obscn UTSW 11 58,990,603 (GRCm39) missense probably damaging 1.00
R7745:Obscn UTSW 11 58,951,681 (GRCm39) missense probably damaging 1.00
R7823:Obscn UTSW 11 58,998,766 (GRCm39) missense probably damaging 1.00
R7840:Obscn UTSW 11 58,968,776 (GRCm39) missense possibly damaging 0.88
R7854:Obscn UTSW 11 58,981,538 (GRCm39) missense probably benign 0.14
R7867:Obscn UTSW 11 58,891,652 (GRCm39) missense unknown
R7874:Obscn UTSW 11 59,024,102 (GRCm39) missense probably damaging 1.00
R7877:Obscn UTSW 11 59,024,588 (GRCm39) missense probably damaging 1.00
R7883:Obscn UTSW 11 58,960,835 (GRCm39) nonsense probably null
R7903:Obscn UTSW 11 58,969,942 (GRCm39) missense probably benign 0.15
R7924:Obscn UTSW 11 59,003,381 (GRCm39) missense probably benign 0.27
R7925:Obscn UTSW 11 59,003,381 (GRCm39) missense probably benign 0.27
R7936:Obscn UTSW 11 58,941,334 (GRCm39) missense possibly damaging 0.46
R7944:Obscn UTSW 11 58,984,235 (GRCm39) missense probably damaging 1.00
R7945:Obscn UTSW 11 58,984,235 (GRCm39) missense probably damaging 1.00
R7984:Obscn UTSW 11 58,997,151 (GRCm39) missense possibly damaging 0.91
R8042:Obscn UTSW 11 58,931,143 (GRCm39) missense possibly damaging 0.61
R8073:Obscn UTSW 11 59,026,516 (GRCm39) missense probably benign 0.25
R8079:Obscn UTSW 11 58,972,731 (GRCm39) missense possibly damaging 0.84
R8108:Obscn UTSW 11 58,952,460 (GRCm39) missense probably benign 0.17
R8117:Obscn UTSW 11 58,932,980 (GRCm39) missense possibly damaging 0.91
R8130:Obscn UTSW 11 59,015,439 (GRCm39) missense probably damaging 1.00
R8135:Obscn UTSW 11 58,922,703 (GRCm39) missense possibly damaging 0.60
R8175:Obscn UTSW 11 58,886,786 (GRCm39) missense unknown
R8205:Obscn UTSW 11 58,898,697 (GRCm39) missense unknown
R8211:Obscn UTSW 11 59,006,620 (GRCm39) missense probably damaging 0.99
R8219:Obscn UTSW 11 59,013,574 (GRCm39) missense probably benign 0.03
R8245:Obscn UTSW 11 58,913,066 (GRCm39) missense
R8290:Obscn UTSW 11 59,015,400 (GRCm39) missense probably damaging 0.99
R8290:Obscn UTSW 11 58,953,536 (GRCm39) missense probably damaging 1.00
R8300:Obscn UTSW 11 58,933,896 (GRCm39) missense probably benign 0.02
R8346:Obscn UTSW 11 58,976,007 (GRCm39) missense possibly damaging 0.80
R8384:Obscn UTSW 11 58,975,935 (GRCm39) missense probably damaging 0.98
R8390:Obscn UTSW 11 58,892,870 (GRCm39) missense probably benign 0.03
R8396:Obscn UTSW 11 58,893,829 (GRCm39) missense probably benign 0.03
R8443:Obscn UTSW 11 58,929,700 (GRCm39) missense probably damaging 0.99
R8469:Obscn UTSW 11 59,019,063 (GRCm39) missense probably damaging 1.00
R8503:Obscn UTSW 11 58,891,443 (GRCm39) missense unknown
R8683:Obscn UTSW 11 58,967,705 (GRCm39) missense probably benign 0.45
R8688:Obscn UTSW 11 58,946,909 (GRCm39) missense probably damaging 1.00
R8711:Obscn UTSW 11 58,951,894 (GRCm39) missense probably damaging 0.96
R8713:Obscn UTSW 11 59,026,792 (GRCm39) missense probably benign 0.03
R8803:Obscn UTSW 11 58,945,229 (GRCm39) missense probably benign
R8807:Obscn UTSW 11 58,970,470 (GRCm39) missense probably damaging 0.99
R8812:Obscn UTSW 11 58,925,921 (GRCm39) missense probably damaging 1.00
R8842:Obscn UTSW 11 58,892,861 (GRCm39) missense possibly damaging 0.56
R8852:Obscn UTSW 11 58,898,440 (GRCm39) missense unknown
R8860:Obscn UTSW 11 58,898,440 (GRCm39) missense unknown
R8878:Obscn UTSW 11 58,890,638 (GRCm39) missense unknown
R8902:Obscn UTSW 11 59,026,762 (GRCm39) missense probably benign 0.03
R8905:Obscn UTSW 11 58,960,784 (GRCm39) missense probably damaging 0.96
R8925:Obscn UTSW 11 58,977,695 (GRCm39) missense possibly damaging 0.90
R8927:Obscn UTSW 11 58,977,695 (GRCm39) missense possibly damaging 0.90
R8934:Obscn UTSW 11 58,889,085 (GRCm39) critical splice donor site probably null
R8936:Obscn UTSW 11 58,892,858 (GRCm39) missense probably benign 0.36
R8950:Obscn UTSW 11 58,947,009 (GRCm39) missense probably damaging 0.99
R8952:Obscn UTSW 11 59,026,960 (GRCm39) missense probably damaging 1.00
R8958:Obscn UTSW 11 58,964,158 (GRCm39) missense probably damaging 0.99
R8960:Obscn UTSW 11 58,922,438 (GRCm39) missense probably damaging 1.00
R8967:Obscn UTSW 11 58,972,740 (GRCm39) missense probably benign 0.11
R8972:Obscn UTSW 11 58,943,442 (GRCm39) missense probably benign 0.15
R8997:Obscn UTSW 11 58,934,629 (GRCm39) intron probably benign
R9012:Obscn UTSW 11 59,021,423 (GRCm39) missense probably benign 0.01
R9053:Obscn UTSW 11 58,972,636 (GRCm39) missense probably benign 0.45
R9064:Obscn UTSW 11 58,899,935 (GRCm39) missense
R9070:Obscn UTSW 11 59,013,457 (GRCm39) missense probably damaging 1.00
R9082:Obscn UTSW 11 58,903,612 (GRCm39) missense probably benign 0.05
R9090:Obscn UTSW 11 59,006,643 (GRCm39) missense probably damaging 0.99
R9144:Obscn UTSW 11 58,960,103 (GRCm39) missense possibly damaging 0.65
R9171:Obscn UTSW 11 58,952,329 (GRCm39) missense possibly damaging 0.47
R9195:Obscn UTSW 11 58,942,040 (GRCm39) missense probably damaging 1.00
R9211:Obscn UTSW 11 59,026,693 (GRCm39) missense probably benign 0.00
R9243:Obscn UTSW 11 59,023,392 (GRCm39) missense probably benign 0.01
R9271:Obscn UTSW 11 59,006,643 (GRCm39) missense probably damaging 0.99
R9288:Obscn UTSW 11 58,976,049 (GRCm39) missense probably benign 0.00
R9297:Obscn UTSW 11 58,898,359 (GRCm39) missense unknown
R9309:Obscn UTSW 11 58,943,337 (GRCm39) missense probably damaging 0.98
R9330:Obscn UTSW 11 58,971,047 (GRCm39) missense possibly damaging 0.95
R9357:Obscn UTSW 11 58,929,592 (GRCm39) missense probably damaging 1.00
R9360:Obscn UTSW 11 58,973,650 (GRCm39) missense probably benign 0.04
R9365:Obscn UTSW 11 58,885,337 (GRCm39) critical splice acceptor site probably null
R9374:Obscn UTSW 11 58,922,787 (GRCm39) missense possibly damaging 0.90
R9388:Obscn UTSW 11 58,943,489 (GRCm39) missense probably damaging 1.00
R9391:Obscn UTSW 11 58,964,408 (GRCm39) missense probably damaging 1.00
R9395:Obscn UTSW 11 58,946,871 (GRCm39) missense probably damaging 0.99
R9406:Obscn UTSW 11 58,947,805 (GRCm39) missense
R9452:Obscn UTSW 11 58,924,962 (GRCm39) critical splice donor site probably null
R9472:Obscn UTSW 11 58,894,495 (GRCm39) missense
R9486:Obscn UTSW 11 58,918,272 (GRCm39) missense
R9515:Obscn UTSW 11 58,994,340 (GRCm39) missense probably benign 0.01
R9585:Obscn UTSW 11 58,965,831 (GRCm39) missense probably benign 0.09
R9597:Obscn UTSW 11 59,027,009 (GRCm39) missense probably benign 0.14
R9602:Obscn UTSW 11 58,981,385 (GRCm39) missense probably damaging 0.99
R9630:Obscn UTSW 11 58,943,397 (GRCm39) missense probably benign 0.16
R9632:Obscn UTSW 11 58,943,397 (GRCm39) missense probably benign 0.16
R9635:Obscn UTSW 11 58,972,686 (GRCm39) missense possibly damaging 0.77
R9710:Obscn UTSW 11 58,943,397 (GRCm39) missense probably benign 0.16
R9750:Obscn UTSW 11 59,024,682 (GRCm39) missense probably benign 0.22
R9757:Obscn UTSW 11 58,892,338 (GRCm39) missense probably benign 0.04
R9779:Obscn UTSW 11 59,026,441 (GRCm39) missense probably benign 0.19
R9788:Obscn UTSW 11 58,969,678 (GRCm39) missense possibly damaging 0.68
R9802:Obscn UTSW 11 58,885,189 (GRCm39) missense unknown
X0010:Obscn UTSW 11 58,886,379 (GRCm39) unclassified probably benign
X0012:Obscn UTSW 11 58,897,602 (GRCm39) missense unknown
X0021:Obscn UTSW 11 58,968,732 (GRCm39) missense probably damaging 0.96
X0058:Obscn UTSW 11 58,926,794 (GRCm39) missense probably damaging 1.00
X0061:Obscn UTSW 11 58,968,656 (GRCm39) missense probably damaging 1.00
X0063:Obscn UTSW 11 58,890,882 (GRCm39) missense unknown
X0067:Obscn UTSW 11 59,022,627 (GRCm39) missense probably benign 0.19
Y4336:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
Y4337:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
Y4338:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
Y5407:Obscn UTSW 11 58,912,769 (GRCm39) missense probably damaging 0.97
Z1176:Obscn UTSW 11 58,885,198 (GRCm39) missense unknown
Z1176:Obscn UTSW 11 58,886,356 (GRCm39) missense unknown
Z1176:Obscn UTSW 11 58,929,633 (GRCm39) missense probably damaging 1.00
Z1176:Obscn UTSW 11 58,931,173 (GRCm39) missense probably benign 0.39
Z1176:Obscn UTSW 11 58,940,551 (GRCm39) missense probably benign 0.01
Z1176:Obscn UTSW 11 58,973,649 (GRCm39) missense probably benign 0.25
Z1176:Obscn UTSW 11 59,027,112 (GRCm39) missense probably benign 0.39
Z1177:Obscn UTSW 11 58,951,841 (GRCm39) missense possibly damaging 0.68
Z1177:Obscn UTSW 11 58,946,865 (GRCm39) missense probably damaging 1.00
Z1177:Obscn UTSW 11 58,946,316 (GRCm39) missense probably damaging 1.00
Z1177:Obscn UTSW 11 58,942,369 (GRCm39) missense probably damaging 0.98
Z1177:Obscn UTSW 11 58,901,270 (GRCm39) missense
Z1177:Obscn UTSW 11 58,891,781 (GRCm39) missense probably benign 0.04
Z1177:Obscn UTSW 11 59,026,292 (GRCm39) missense possibly damaging 0.50
Z1177:Obscn UTSW 11 58,953,713 (GRCm39) missense probably damaging 1.00
Z1177:Obscn UTSW 11 58,952,913 (GRCm39) missense probably damaging 1.00
Z1186:Obscn UTSW 11 58,994,340 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,994,167 (GRCm39) missense probably damaging 1.00
Z1186:Obscn UTSW 11 58,990,755 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,990,735 (GRCm39) missense possibly damaging 0.66
Z1186:Obscn UTSW 11 58,984,385 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,984,335 (GRCm39) missense probably benign 0.29
Z1186:Obscn UTSW 11 58,984,334 (GRCm39) missense possibly damaging 0.95
Z1186:Obscn UTSW 11 58,984,239 (GRCm39) missense possibly damaging 0.82
Z1186:Obscn UTSW 11 58,984,142 (GRCm39) missense probably benign
Z1186:Obscn UTSW 11 58,977,565 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,977,527 (GRCm39) missense probably benign
Z1186:Obscn UTSW 11 58,977,505 (GRCm39) missense probably benign 0.04
Z1186:Obscn UTSW 11 58,972,698 (GRCm39) missense possibly damaging 0.96
Z1186:Obscn UTSW 11 58,970,722 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,969,984 (GRCm39) missense probably damaging 1.00
Z1186:Obscn UTSW 11 58,967,334 (GRCm39) missense possibly damaging 0.71
Z1186:Obscn UTSW 11 58,960,757 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,958,655 (GRCm39) missense probably benign 0.01
Z1186:Obscn UTSW 11 58,957,973 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,954,402 (GRCm39) missense probably damaging 1.00
Z1186:Obscn UTSW 11 58,954,300 (GRCm39) missense
Z1186:Obscn UTSW 11 58,954,279 (GRCm39) frame shift probably null
Z1186:Obscn UTSW 11 58,952,388 (GRCm39) missense probably benign 0.01
Z1186:Obscn UTSW 11 58,947,595 (GRCm39) missense
Z1186:Obscn UTSW 11 59,023,937 (GRCm39) missense possibly damaging 0.48
Z1186:Obscn UTSW 11 59,024,066 (GRCm39) missense probably damaging 1.00
Z1186:Obscn UTSW 11 59,024,072 (GRCm39) missense probably benign 0.01
Z1186:Obscn UTSW 11 59,026,505 (GRCm39) missense probably benign 0.05
Z1186:Obscn UTSW 11 58,946,331 (GRCm39) missense probably damaging 0.99
Z1186:Obscn UTSW 11 58,946,340 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,946,936 (GRCm39) missense possibly damaging 0.85
Z1186:Obscn UTSW 11 59,021,449 (GRCm39) missense probably damaging 0.98
Z1186:Obscn UTSW 11 58,929,976 (GRCm39) missense probably benign 0.43
Z1186:Obscn UTSW 11 58,921,934 (GRCm39) missense probably damaging 0.97
Z1186:Obscn UTSW 11 58,904,014 (GRCm39) missense probably benign 0.07
Z1186:Obscn UTSW 11 58,900,019 (GRCm39) missense probably benign 0.01
Z1186:Obscn UTSW 11 58,891,715 (GRCm39) missense probably benign 0.35
Z1186:Obscn UTSW 11 58,945,176 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,945,044 (GRCm39) missense probably benign
Z1186:Obscn UTSW 11 58,944,651 (GRCm39) missense probably benign
Z1186:Obscn UTSW 11 58,944,594 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,943,439 (GRCm39) missense probably benign 0.01
Z1186:Obscn UTSW 11 58,942,383 (GRCm39) missense probably benign 0.11
Z1186:Obscn UTSW 11 58,940,623 (GRCm39) missense
Z1186:Obscn UTSW 11 58,940,614 (GRCm39) missense possibly damaging 0.89
Z1186:Obscn UTSW 11 58,940,306 (GRCm39) missense
Z1186:Obscn UTSW 11 58,933,878 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,933,853 (GRCm39) missense probably benign 0.13
Z1186:Obscn UTSW 11 58,933,776 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,932,601 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,929,990 (GRCm39) missense probably damaging 0.97
Z1186:Obscn UTSW 11 59,018,895 (GRCm39) missense probably damaging 0.99
Z1186:Obscn UTSW 11 59,018,892 (GRCm39) missense probably benign 0.06
Z1186:Obscn UTSW 11 59,013,563 (GRCm39) missense probably benign 0.01
Z1186:Obscn UTSW 11 59,003,380 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,994,364 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,984,334 (GRCm39) missense possibly damaging 0.95
Z1187:Obscn UTSW 11 58,984,239 (GRCm39) missense possibly damaging 0.82
Z1187:Obscn UTSW 11 58,984,142 (GRCm39) missense probably benign
Z1187:Obscn UTSW 11 58,977,565 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,977,527 (GRCm39) missense probably benign
Z1187:Obscn UTSW 11 58,977,505 (GRCm39) missense probably benign 0.04
Z1187:Obscn UTSW 11 58,972,698 (GRCm39) missense possibly damaging 0.96
Z1187:Obscn UTSW 11 58,970,722 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,969,984 (GRCm39) missense probably damaging 1.00
Z1187:Obscn UTSW 11 58,967,334 (GRCm39) missense possibly damaging 0.71
Z1187:Obscn UTSW 11 58,960,757 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,960,659 (GRCm39) synonymous silent
Z1187:Obscn UTSW 11 58,958,655 (GRCm39) missense probably benign 0.01
Z1187:Obscn UTSW 11 58,957,973 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,954,402 (GRCm39) missense probably damaging 1.00
Z1187:Obscn UTSW 11 58,954,300 (GRCm39) missense
Z1187:Obscn UTSW 11 58,954,279 (GRCm39) frame shift probably null
Z1187:Obscn UTSW 11 58,952,388 (GRCm39) missense probably benign 0.01
Z1187:Obscn UTSW 11 58,951,823 (GRCm39) missense probably damaging 1.00
Z1187:Obscn UTSW 11 58,947,595 (GRCm39) missense
Z1187:Obscn UTSW 11 58,946,936 (GRCm39) missense possibly damaging 0.85
Z1187:Obscn UTSW 11 58,946,340 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,946,331 (GRCm39) missense probably damaging 0.99
Z1187:Obscn UTSW 11 58,945,176 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,945,044 (GRCm39) missense probably benign
Z1187:Obscn UTSW 11 59,026,505 (GRCm39) missense probably benign 0.05
Z1187:Obscn UTSW 11 59,024,072 (GRCm39) missense probably benign 0.01
Z1187:Obscn UTSW 11 59,024,066 (GRCm39) missense probably damaging 1.00
Z1187:Obscn UTSW 11 59,023,937 (GRCm39) missense possibly damaging 0.48
Z1187:Obscn UTSW 11 59,021,449 (GRCm39) missense probably damaging 0.98
Z1187:Obscn UTSW 11 59,020,663 (GRCm39) missense probably benign 0.11
Z1187:Obscn UTSW 11 59,018,895 (GRCm39) missense probably damaging 0.99
Z1187:Obscn UTSW 11 59,018,892 (GRCm39) missense probably benign 0.06
Z1187:Obscn UTSW 11 59,013,563 (GRCm39) missense probably benign 0.01
Z1187:Obscn UTSW 11 59,003,380 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,904,014 (GRCm39) missense probably benign 0.07
Z1187:Obscn UTSW 11 58,900,019 (GRCm39) missense probably benign 0.01
Z1187:Obscn UTSW 11 58,891,715 (GRCm39) missense probably benign 0.35
Z1187:Obscn UTSW 11 58,944,651 (GRCm39) missense probably benign
Z1187:Obscn UTSW 11 58,944,594 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,943,439 (GRCm39) missense probably benign 0.01
Z1187:Obscn UTSW 11 58,942,383 (GRCm39) missense probably benign 0.11
Z1187:Obscn UTSW 11 58,940,623 (GRCm39) missense
Z1187:Obscn UTSW 11 58,940,614 (GRCm39) missense possibly damaging 0.89
Z1187:Obscn UTSW 11 58,940,306 (GRCm39) missense
Z1187:Obscn UTSW 11 58,933,878 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,933,853 (GRCm39) missense probably benign 0.13
Z1187:Obscn UTSW 11 58,933,776 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,932,601 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,929,990 (GRCm39) missense probably damaging 0.97
Z1187:Obscn UTSW 11 58,929,976 (GRCm39) missense probably benign 0.43
Z1187:Obscn UTSW 11 58,921,934 (GRCm39) missense probably damaging 0.97
Z1187:Obscn UTSW 11 58,994,364 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,994,340 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,994,167 (GRCm39) missense probably damaging 1.00
Z1187:Obscn UTSW 11 58,990,755 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,990,735 (GRCm39) missense possibly damaging 0.66
Z1187:Obscn UTSW 11 58,984,385 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,984,335 (GRCm39) missense probably benign 0.29
Z1188:Obscn UTSW 11 58,969,984 (GRCm39) missense probably damaging 1.00
Z1188:Obscn UTSW 11 58,967,334 (GRCm39) missense possibly damaging 0.71
Z1188:Obscn UTSW 11 58,960,757 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 58,958,655 (GRCm39) missense probably benign 0.01
Z1188:Obscn UTSW 11 58,957,973 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 58,954,402 (GRCm39) missense probably damaging 1.00
Z1188:Obscn UTSW 11 58,954,300 (GRCm39) missense
Z1188:Obscn UTSW 11 58,954,279 (GRCm39) frame shift probably null
Z1188:Obscn UTSW 11 58,952,965 (GRCm39) missense probably damaging 0.97
Z1188:Obscn UTSW 11 58,952,959 (GRCm39) missense probably benign
Z1188:Obscn UTSW 11 58,952,408 (GRCm39) missense probably benign 0.37
Z1188:Obscn UTSW 11 58,952,388 (GRCm39) missense probably benign 0.01
Z1188:Obscn UTSW 11 58,951,823 (GRCm39) missense probably damaging 1.00
Z1188:Obscn UTSW 11 58,947,595 (GRCm39) missense
Z1188:Obscn UTSW 11 58,946,936 (GRCm39) missense possibly damaging 0.85
Z1188:Obscn UTSW 11 58,946,340 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 58,946,331 (GRCm39) missense probably damaging 0.99
Z1188:Obscn UTSW 11 58,946,283 (GRCm39) missense probably damaging 1.00
Z1188:Obscn UTSW 11 58,945,660 (GRCm39) missense probably benign 0.04
Z1188:Obscn UTSW 11 58,945,176 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 59,026,505 (GRCm39) missense probably benign 0.05
Z1188:Obscn UTSW 11 59,024,072 (GRCm39) missense probably benign 0.01
Z1188:Obscn UTSW 11 59,024,066 (GRCm39) missense probably damaging 1.00
Z1188:Obscn UTSW 11 59,023,937 (GRCm39) missense possibly damaging 0.48
Z1188:Obscn UTSW 11 59,021,449 (GRCm39) missense probably damaging 0.98
Z1188:Obscn UTSW 11 59,020,663 (GRCm39) missense probably benign 0.11
Z1188:Obscn UTSW 11 59,020,513 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 59,018,895 (GRCm39) missense probably damaging 0.99
Z1188:Obscn UTSW 11 59,018,892 (GRCm39) missense probably benign 0.06
Z1188:Obscn UTSW 11 59,013,563 (GRCm39) missense probably benign 0.01
Z1188:Obscn UTSW 11 59,003,462 (GRCm39) missense probably benign 0.01
Z1188:Obscn UTSW 11 59,003,380 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 58,994,364 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 58,994,340 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 58,994,167 (GRCm39) missense probably damaging 1.00
Z1188:Obscn UTSW 11 58,990,755 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 58,921,934 (GRCm39) missense probably damaging 0.97
Z1188:Obscn UTSW 11 58,904,014 (GRCm39) missense probably benign 0.07
Z1188:Obscn UTSW 11 58,900,019 (GRCm39) missense probably benign 0.01
Z1188:Obscn UTSW 11 58,891,715 (GRCm39) missense probably benign 0.35
Z1188:Obscn UTSW 11 58,945,044 (GRCm39) missense probably benign
Z1188:Obscn UTSW 11 58,944,651 (GRCm39) missense probably benign
Z1188:Obscn UTSW 11 58,944,594 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 58,943,439 (GRCm39) missense probably benign 0.01
Z1188:Obscn UTSW 11 58,942,383 (GRCm39) missense probably benign 0.11
Z1188:Obscn UTSW 11 58,940,623 (GRCm39) missense
Z1188:Obscn UTSW 11 58,940,614 (GRCm39) missense possibly damaging 0.89
Z1188:Obscn UTSW 11 58,940,306 (GRCm39) missense
Z1188:Obscn UTSW 11 58,933,878 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 58,933,853 (GRCm39) missense probably benign 0.13
Z1188:Obscn UTSW 11 58,933,776 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 58,932,601 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 58,929,990 (GRCm39) missense probably damaging 0.97
Z1188:Obscn UTSW 11 58,929,976 (GRCm39) missense probably benign 0.43
Z1188:Obscn UTSW 11 58,990,735 (GRCm39) missense possibly damaging 0.66
Z1188:Obscn UTSW 11 58,984,385 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 58,984,335 (GRCm39) missense probably benign 0.29
Z1188:Obscn UTSW 11 58,984,334 (GRCm39) missense possibly damaging 0.95
Z1188:Obscn UTSW 11 58,984,239 (GRCm39) missense possibly damaging 0.82
Z1188:Obscn UTSW 11 58,984,142 (GRCm39) missense probably benign
Z1188:Obscn UTSW 11 58,981,573 (GRCm39) missense probably benign
Z1188:Obscn UTSW 11 58,977,565 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 58,977,527 (GRCm39) missense probably benign
Z1188:Obscn UTSW 11 58,977,505 (GRCm39) missense probably benign 0.04
Z1188:Obscn UTSW 11 58,972,698 (GRCm39) missense possibly damaging 0.96
Z1188:Obscn UTSW 11 58,970,722 (GRCm39) missense probably benign 0.00
Z1189:Obscn UTSW 11 58,954,300 (GRCm39) missense
Z1189:Obscn UTSW 11 58,954,402 (GRCm39) missense probably damaging 1.00
Z1189:Obscn UTSW 11 58,957,973 (GRCm39) missense probably benign 0.00
Z1189:Obscn UTSW 11 58,958,655 (GRCm39) missense probably benign 0.01
Z1189:Obscn UTSW 11 58,960,757 (GRCm39) missense probably benign 0.00
Z1189:Obscn UTSW 11 58,967,334 (GRCm39) missense possibly damaging 0.71
Z1189:Obscn UTSW 11 58,969,984 (GRCm39) missense probably damaging 1.00
Z1189:Obscn UTSW 11 58,970,722 (GRCm39) missense probably benign 0.00
Z1189:Obscn UTSW 11 58,972,698 (GRCm39) missense possibly damaging 0.96
Z1189:Obscn UTSW 11 58,977,505 (GRCm39) missense probably benign 0.04
Z1189:Obscn UTSW 11 58,977,527 (GRCm39) missense probably benign
Z1189:Obscn UTSW 11 58,984,142 (GRCm39) missense probably benign
Z1189:Obscn UTSW 11 58,984,239 (GRCm39) missense possibly damaging 0.82
Z1189:Obscn UTSW 11 58,984,334 (GRCm39) missense possibly damaging 0.95
Z1189:Obscn UTSW 11 58,984,335 (GRCm39) missense probably benign 0.29
Z1189:Obscn UTSW 11 58,984,385 (GRCm39) missense probably benign 0.00
Z1189:Obscn UTSW 11 58,994,167 (GRCm39) missense probably damaging 1.00
Z1189:Obscn UTSW 11 58,994,364 (GRCm39) missense probably benign 0.00
Z1189:Obscn UTSW 11 59,003,380 (GRCm39) missense probably benign 0.00
Z1189:Obscn UTSW 11 59,013,563 (GRCm39) missense probably benign 0.01
Z1189:Obscn UTSW 11 59,021,449 (GRCm39) missense probably damaging 0.98
Z1189:Obscn UTSW 11 59,023,937 (GRCm39) missense possibly damaging 0.48
Z1189:Obscn UTSW 11 59,024,066 (GRCm39) missense probably damaging 1.00
Z1189:Obscn UTSW 11 59,024,072 (GRCm39) missense probably benign 0.01
Z1189:Obscn UTSW 11 59,026,505 (GRCm39) missense probably benign 0.05
Z1189:Obscn UTSW 11 58,929,990 (GRCm39) missense probably damaging 0.97
Z1189:Obscn UTSW 11 58,933,776 (GRCm39) missense probably benign 0.00
Z1189:Obscn UTSW 11 58,933,853 (GRCm39) missense probably benign 0.13
Z1189:Obscn UTSW 11 58,933,878 (GRCm39) missense probably benign 0.00
Z1189:Obscn UTSW 11 58,940,306 (GRCm39) missense
Z1189:Obscn UTSW 11 58,940,614 (GRCm39) missense possibly damaging 0.89
Z1189:Obscn UTSW 11 58,940,623 (GRCm39) missense
Z1189:Obscn UTSW 11 58,942,383 (GRCm39) missense probably benign 0.11
Z1189:Obscn UTSW 11 58,943,439 (GRCm39) missense probably benign 0.01
Z1189:Obscn UTSW 11 58,944,594 (GRCm39) missense probably benign 0.00
Z1189:Obscn UTSW 11 58,944,651 (GRCm39) missense probably benign
Z1189:Obscn UTSW 11 58,945,044 (GRCm39) missense probably benign
Z1189:Obscn UTSW 11 58,945,176 (GRCm39) missense probably benign 0.00
Z1189:Obscn UTSW 11 58,946,331 (GRCm39) missense probably damaging 0.99
Z1189:Obscn UTSW 11 58,891,715 (GRCm39) missense probably benign 0.35
Z1189:Obscn UTSW 11 58,900,019 (GRCm39) missense probably benign 0.01
Z1189:Obscn UTSW 11 58,904,014 (GRCm39) missense probably benign 0.07
Z1189:Obscn UTSW 11 58,921,934 (GRCm39) missense probably damaging 0.97
Z1189:Obscn UTSW 11 58,929,976 (GRCm39) missense probably benign 0.43
Z1189:Obscn UTSW 11 58,946,936 (GRCm39) missense possibly damaging 0.85
Z1189:Obscn UTSW 11 58,947,595 (GRCm39) missense
Z1190:Obscn UTSW 11 58,977,755 (GRCm39) missense probably benign 0.15
Z1190:Obscn UTSW 11 58,977,565 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,977,527 (GRCm39) missense probably benign
Z1190:Obscn UTSW 11 58,977,505 (GRCm39) missense probably benign 0.04
Z1190:Obscn UTSW 11 58,972,698 (GRCm39) missense possibly damaging 0.96
Z1190:Obscn UTSW 11 58,970,722 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,969,984 (GRCm39) missense probably damaging 1.00
Z1190:Obscn UTSW 11 58,967,334 (GRCm39) missense possibly damaging 0.71
Z1190:Obscn UTSW 11 58,960,757 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,958,655 (GRCm39) missense probably benign 0.01
Z1190:Obscn UTSW 11 58,957,973 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,954,402 (GRCm39) missense probably damaging 1.00
Z1190:Obscn UTSW 11 58,954,300 (GRCm39) missense
Z1190:Obscn UTSW 11 58,954,279 (GRCm39) frame shift probably null
Z1190:Obscn UTSW 11 58,952,965 (GRCm39) missense probably damaging 0.97
Z1190:Obscn UTSW 11 58,952,408 (GRCm39) missense probably benign 0.37
Z1190:Obscn UTSW 11 58,952,388 (GRCm39) missense probably benign 0.01
Z1190:Obscn UTSW 11 58,951,823 (GRCm39) missense probably damaging 1.00
Z1190:Obscn UTSW 11 58,947,595 (GRCm39) missense
Z1190:Obscn UTSW 11 58,946,936 (GRCm39) missense possibly damaging 0.85
Z1190:Obscn UTSW 11 58,946,340 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,946,331 (GRCm39) missense probably damaging 0.99
Z1190:Obscn UTSW 11 58,946,283 (GRCm39) missense probably damaging 1.00
Z1190:Obscn UTSW 11 59,026,505 (GRCm39) missense probably benign 0.05
Z1190:Obscn UTSW 11 59,024,072 (GRCm39) missense probably benign 0.01
Z1190:Obscn UTSW 11 59,024,066 (GRCm39) missense probably damaging 1.00
Z1190:Obscn UTSW 11 59,023,937 (GRCm39) missense possibly damaging 0.48
Z1190:Obscn UTSW 11 59,021,449 (GRCm39) missense probably damaging 0.98
Z1190:Obscn UTSW 11 59,020,663 (GRCm39) missense probably benign 0.11
Z1190:Obscn UTSW 11 59,013,664 (GRCm39) missense probably benign
Z1190:Obscn UTSW 11 59,018,892 (GRCm39) missense probably benign 0.06
Z1190:Obscn UTSW 11 59,018,895 (GRCm39) missense probably damaging 0.99
Z1190:Obscn UTSW 11 59,013,563 (GRCm39) missense probably benign 0.01
Z1190:Obscn UTSW 11 59,003,380 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,994,364 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,929,976 (GRCm39) missense probably benign 0.43
Z1190:Obscn UTSW 11 58,921,934 (GRCm39) missense probably damaging 0.97
Z1190:Obscn UTSW 11 58,904,014 (GRCm39) missense probably benign 0.07
Z1190:Obscn UTSW 11 58,900,019 (GRCm39) missense probably benign 0.01
Z1190:Obscn UTSW 11 58,891,715 (GRCm39) missense probably benign 0.35
Z1190:Obscn UTSW 11 58,945,660 (GRCm39) missense probably benign 0.04
Z1190:Obscn UTSW 11 58,945,176 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,945,044 (GRCm39) missense probably benign
Z1190:Obscn UTSW 11 58,944,651 (GRCm39) missense probably benign
Z1190:Obscn UTSW 11 58,944,594 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,943,439 (GRCm39) missense probably benign 0.01
Z1190:Obscn UTSW 11 58,942,383 (GRCm39) missense probably benign 0.11
Z1190:Obscn UTSW 11 58,940,623 (GRCm39) missense
Z1190:Obscn UTSW 11 58,940,614 (GRCm39) missense possibly damaging 0.89
Z1190:Obscn UTSW 11 58,940,306 (GRCm39) missense
Z1190:Obscn UTSW 11 58,933,878 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,933,853 (GRCm39) missense probably benign 0.13
Z1190:Obscn UTSW 11 58,933,776 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,929,990 (GRCm39) missense probably damaging 0.97
Z1190:Obscn UTSW 11 58,994,340 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,994,167 (GRCm39) missense probably damaging 1.00
Z1190:Obscn UTSW 11 58,990,755 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,990,735 (GRCm39) missense possibly damaging 0.66
Z1190:Obscn UTSW 11 58,984,385 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,984,335 (GRCm39) missense probably benign 0.29
Z1190:Obscn UTSW 11 58,984,334 (GRCm39) missense possibly damaging 0.95
Z1190:Obscn UTSW 11 58,984,239 (GRCm39) missense possibly damaging 0.82
Z1190:Obscn UTSW 11 58,984,142 (GRCm39) missense probably benign
Z1191:Obscn UTSW 11 58,969,984 (GRCm39) missense probably damaging 1.00
Z1191:Obscn UTSW 11 58,967,334 (GRCm39) missense possibly damaging 0.71
Z1191:Obscn UTSW 11 58,960,757 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 58,958,655 (GRCm39) missense probably benign 0.01
Z1191:Obscn UTSW 11 58,957,973 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 58,954,402 (GRCm39) missense probably damaging 1.00
Z1191:Obscn UTSW 11 58,954,300 (GRCm39) missense
Z1191:Obscn UTSW 11 58,954,279 (GRCm39) frame shift probably null
Z1191:Obscn UTSW 11 58,952,965 (GRCm39) missense probably damaging 0.97
Z1191:Obscn UTSW 11 58,952,959 (GRCm39) missense probably benign
Z1191:Obscn UTSW 11 58,952,408 (GRCm39) missense probably benign 0.37
Z1191:Obscn UTSW 11 58,952,388 (GRCm39) missense probably benign 0.01
Z1191:Obscn UTSW 11 58,951,823 (GRCm39) missense probably damaging 1.00
Z1191:Obscn UTSW 11 58,947,595 (GRCm39) missense
Z1191:Obscn UTSW 11 58,946,936 (GRCm39) missense possibly damaging 0.85
Z1191:Obscn UTSW 11 58,946,340 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 58,946,331 (GRCm39) missense probably damaging 0.99
Z1191:Obscn UTSW 11 58,946,283 (GRCm39) missense probably damaging 1.00
Z1191:Obscn UTSW 11 58,945,660 (GRCm39) missense probably benign 0.04
Z1191:Obscn UTSW 11 58,945,176 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 59,026,505 (GRCm39) missense probably benign 0.05
Z1191:Obscn UTSW 11 59,024,072 (GRCm39) missense probably benign 0.01
Z1191:Obscn UTSW 11 59,024,066 (GRCm39) missense probably damaging 1.00
Z1191:Obscn UTSW 11 59,023,937 (GRCm39) missense possibly damaging 0.48
Z1191:Obscn UTSW 11 59,021,449 (GRCm39) missense probably damaging 0.98
Z1191:Obscn UTSW 11 59,020,663 (GRCm39) missense probably benign 0.11
Z1191:Obscn UTSW 11 59,020,513 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 59,019,075 (GRCm39) missense probably damaging 1.00
Z1191:Obscn UTSW 11 59,018,895 (GRCm39) missense probably damaging 0.99
Z1191:Obscn UTSW 11 59,018,892 (GRCm39) missense probably benign 0.06
Z1191:Obscn UTSW 11 59,013,664 (GRCm39) missense probably benign
Z1191:Obscn UTSW 11 59,013,563 (GRCm39) missense probably benign 0.01
Z1191:Obscn UTSW 11 59,003,462 (GRCm39) missense probably benign 0.01
Z1191:Obscn UTSW 11 59,003,380 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 58,994,364 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 58,994,340 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 58,994,167 (GRCm39) missense probably damaging 1.00
Z1191:Obscn UTSW 11 58,990,755 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 58,929,976 (GRCm39) missense probably benign 0.43
Z1191:Obscn UTSW 11 58,921,934 (GRCm39) missense probably damaging 0.97
Z1191:Obscn UTSW 11 58,904,014 (GRCm39) missense probably benign 0.07
Z1191:Obscn UTSW 11 58,900,019 (GRCm39) missense probably benign 0.01
Z1191:Obscn UTSW 11 58,891,715 (GRCm39) missense probably benign 0.35
Z1191:Obscn UTSW 11 58,945,044 (GRCm39) missense probably benign
Z1191:Obscn UTSW 11 58,944,651 (GRCm39) missense probably benign
Z1191:Obscn UTSW 11 58,944,594 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 58,943,439 (GRCm39) missense probably benign 0.01
Z1191:Obscn UTSW 11 58,942,383 (GRCm39) missense probably benign 0.11
Z1191:Obscn UTSW 11 58,940,623 (GRCm39) missense
Z1191:Obscn UTSW 11 58,940,614 (GRCm39) missense possibly damaging 0.89
Z1191:Obscn UTSW 11 58,940,306 (GRCm39) missense
Z1191:Obscn UTSW 11 58,933,878 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 58,933,853 (GRCm39) missense probably benign 0.13
Z1191:Obscn UTSW 11 58,933,776 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 58,932,674 (GRCm39) critical splice acceptor site probably null
Z1191:Obscn UTSW 11 58,932,601 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 58,929,990 (GRCm39) missense probably damaging 0.97
Z1191:Obscn UTSW 11 58,990,735 (GRCm39) missense possibly damaging 0.66
Z1191:Obscn UTSW 11 58,984,385 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 58,984,335 (GRCm39) missense probably benign 0.29
Z1191:Obscn UTSW 11 58,984,334 (GRCm39) missense possibly damaging 0.95
Z1191:Obscn UTSW 11 58,984,239 (GRCm39) missense possibly damaging 0.82
Z1191:Obscn UTSW 11 58,984,142 (GRCm39) missense probably benign
Z1191:Obscn UTSW 11 58,981,573 (GRCm39) missense probably benign
Z1191:Obscn UTSW 11 58,977,565 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 58,977,527 (GRCm39) missense probably benign
Z1191:Obscn UTSW 11 58,977,505 (GRCm39) missense probably benign 0.04
Z1191:Obscn UTSW 11 58,972,698 (GRCm39) missense possibly damaging 0.96
Z1191:Obscn UTSW 11 58,970,722 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 58,994,167 (GRCm39) missense probably damaging 1.00
Z1192:Obscn UTSW 11 58,990,755 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 58,990,735 (GRCm39) missense possibly damaging 0.66
Z1192:Obscn UTSW 11 58,984,385 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 58,984,335 (GRCm39) missense probably benign 0.29
Z1192:Obscn UTSW 11 58,984,334 (GRCm39) missense possibly damaging 0.95
Z1192:Obscn UTSW 11 58,984,239 (GRCm39) missense possibly damaging 0.82
Z1192:Obscn UTSW 11 58,984,142 (GRCm39) missense probably benign
Z1192:Obscn UTSW 11 58,977,565 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 58,977,527 (GRCm39) missense probably benign
Z1192:Obscn UTSW 11 58,977,505 (GRCm39) missense probably benign 0.04
Z1192:Obscn UTSW 11 58,972,698 (GRCm39) missense possibly damaging 0.96
Z1192:Obscn UTSW 11 58,970,722 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 58,969,984 (GRCm39) missense probably damaging 1.00
Z1192:Obscn UTSW 11 58,967,334 (GRCm39) missense possibly damaging 0.71
Z1192:Obscn UTSW 11 58,960,757 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 58,958,655 (GRCm39) missense probably benign 0.01
Z1192:Obscn UTSW 11 58,957,973 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 58,954,402 (GRCm39) missense probably damaging 1.00
Z1192:Obscn UTSW 11 58,952,388 (GRCm39) missense probably benign 0.01
Z1192:Obscn UTSW 11 58,947,595 (GRCm39) missense
Z1192:Obscn UTSW 11 58,946,936 (GRCm39) missense possibly damaging 0.85
Z1192:Obscn UTSW 11 58,946,340 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 58,946,331 (GRCm39) missense probably damaging 0.99
Z1192:Obscn UTSW 11 58,945,176 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 59,026,505 (GRCm39) missense probably benign 0.05
Z1192:Obscn UTSW 11 58,994,364 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 59,003,380 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 59,013,563 (GRCm39) missense probably benign 0.01
Z1192:Obscn UTSW 11 59,018,892 (GRCm39) missense probably benign 0.06
Z1192:Obscn UTSW 11 59,018,895 (GRCm39) missense probably damaging 0.99
Z1192:Obscn UTSW 11 59,021,449 (GRCm39) missense probably damaging 0.98
Z1192:Obscn UTSW 11 59,023,937 (GRCm39) missense possibly damaging 0.48
Z1192:Obscn UTSW 11 58,929,976 (GRCm39) missense probably benign 0.43
Z1192:Obscn UTSW 11 58,929,990 (GRCm39) missense probably damaging 0.97
Z1192:Obscn UTSW 11 58,932,601 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 58,933,776 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 58,933,853 (GRCm39) missense probably benign 0.13
Z1192:Obscn UTSW 11 58,933,878 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 58,940,306 (GRCm39) missense
Z1192:Obscn UTSW 11 58,940,614 (GRCm39) missense possibly damaging 0.89
Z1192:Obscn UTSW 11 58,940,623 (GRCm39) missense
Z1192:Obscn UTSW 11 58,942,383 (GRCm39) missense probably benign 0.11
Z1192:Obscn UTSW 11 58,943,439 (GRCm39) missense probably benign 0.01
Z1192:Obscn UTSW 11 58,944,594 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 58,944,651 (GRCm39) missense probably benign
Z1192:Obscn UTSW 11 58,945,044 (GRCm39) missense probably benign
Z1192:Obscn UTSW 11 58,891,715 (GRCm39) missense probably benign 0.35
Z1192:Obscn UTSW 11 58,900,019 (GRCm39) missense probably benign 0.01
Z1192:Obscn UTSW 11 58,904,014 (GRCm39) missense probably benign 0.07
Z1192:Obscn UTSW 11 58,921,934 (GRCm39) missense probably damaging 0.97
Z1192:Obscn UTSW 11 59,024,066 (GRCm39) missense probably damaging 1.00
Z1192:Obscn UTSW 11 59,024,072 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATTGCCTCTTTGCTCCAGAG -3'
(R):5'- AACCCTGGAGTGTCTGAGAG -3'

Sequencing Primer
(F):5'- GTTGGTTACCCAGGACACC -3'
(R):5'- CTGAGAGGAGACCCCGATGTTTG -3'
Posted On 2016-10-26